Descent of Mankind Theory: Disproved by Molecular Biology
by Rich Deem
Introduction
The current theory of human evolution states that modern humans evolved from more primitive
bipedal hominids. The first
bipedal hominid genus that is supposedly the ancestor of modern humans is
Australopithecus, which appeared in the fossil record from about 4.4 to 1 million years ago throughout eastern Africa.
Australopithecus comprised a diverse group of small-brained
bipedal species that were confined to the savannas of Africa. This
genus was supposed to have evolved into the
genus Homo, which has been defined as
bipedal primates with a brain capacity over 700 cc, having appeared in the fossil record by about 2.5 million years ago as
Homo habilis in eastern Africa. According to theory,
Homo habilis evolved into
Homo erectus, which had a brain capacity just over 1000 cc, appearing in the fossil record from about 1.8 million to 300 thousand years ago.
Homo neanderthalensis lived between 400 and 28 thousand years ago. Archaic
Homo sapiens appeared 400 - 150 thousand years ago, and modern
Homo sapiens from less than 100 thousand years ago. Contrary to the claims of many creationists, there is ample evidence for the existence of human-like species of
bipedal primates. The dates and ages of these fossils are not widely disputed in scientific circles. The reality of the fossil record and the reliability of the dates of these fossils is actually instrumental in disproving the descent of man theory. If the fossil record were not as complete as it now is, the standard evolutionist argument would apply, "we just haven't found the missing link ancestor of modern humans yet."
The beginning of trouble - lack of genetic diversity among modern humans
As evolutionists studied humans and species of apes in the 1970's and 1980's, some rather surprising information was being discovered that distinguished us from apes and other
primates. The maximum
Fst value (a measure of variation between population groups) between human races is 0.08 (
1,
2). However, among populations of
chimpanzees, orangutans, and other
primate species,
Fst values are commonly more than 0.20. An examination of 62 common
protein coding genetic
loci, indicates a
substitution rate of 0.011/
locus (
Caucasoids versus
Mongoloids), to a maximum of 0.029 (
Mongoloids versus
Negroids). However, in nearly all other animal species studied, including apes, usually exceed 0.05 (
2). In humans,
heterozygosity (the proportion of
alleles that are
polymorphic, in this case within the species) is 1.8% , whereas in apes it ranges from 2.5 in the
Orangutan to 3.9 in the
Chimpanzee (
3). An analysis of the genetics of populations of apes reveals that different population groups possess fixed novel
mutations that characterize each population. In contrast, there are no novel
mutations or genetic
alleles that specifically characterize any one human race from another. More recent studies have confirmed the early work, likewise showing that human genetic diversity is far less than what one would predict from Darwinian theory. Dr. Maryellen Ruvolo (Harvard University) has noted, "It's a mystery none of us can explain." (
4). Examinations of the genetic
sequences of diverse modern human populations reveals minor, if any differences (
5). All of this evidence suggested a recent origin for modern humans.
Still more trouble - Discontinuous morphological changes in the hominid lineage
Paleontological discoveries and
geochronology show that the pattern of morphological change in the
hominid fossil record was not progressive, but abrupt (
6). Some adaptations essential to
bipedalism appeared early, but others appeared much later. Although the 3.2 million year old fossil "Lucy" (
Australopithecus aferensis), was said to be
bipedal, her 2.6 million year old descendent,
Australopithecus africanus, was indisputably
arboreal (
7). Primitive
craniodental complexes (similar to the reconstructed last common ancestor with the African great apes) were found in nearly all species of
Hominidae (
8). Relative brain size increased slightly among successively younger species of
Australopithecines, although many
Australopithecine skulls have brain capacities no larger than those of
chimpanzees. (
9,
10). However, brain capacities expanded abruptly with the appearance of
Homo, but within early
Homo remained at about half the size of
Homo sapiens for almost a million years. The fossil record indicates an accumulation of relatively rapid shifts in successive species, and certainly not any kind of gradualistic changes.
A recent study examined the
mutation rate for humans. Using "conservative assumptions" the authors found that the overall
mutation rates was 4.2
mutations per person per generation, with a
deleterious rate of 1.6 (
11). When using more realistic assumptions the overall
mutation rate for humans become 6.7 with a
deleterious rate of 3.1. Such a high rate should have resulted in extinction of our species long ago. They stated in their conclusion:
"The deleterious mutation rate appears to be so high in humans and our close relatives that it is doubtful that such species, which have low reproductive rates, could survive if mutational effects on fitness were to combine in a multiplicative way."
The authors had to rely upon a rare association of
mutations, termed synergistic
epistasis to explain why the numerous hypothesized
deleterious mutations have not overwhelmed our
genome. Instead of postulating the obvious (that the human
genome is not as old as evolution would teach), evolutionists must rely upon the improbable to retain the evolutionary paradigm.
Recent origin of modern humans confirmed through molecular biology
In the late 1980's and early 1990's a number of studies were done examining the
mitochondrial DNA (
mtDNA) of women all over the world. These studies, nicknamed the "Eve theory," suggested that the last common ancestor of modern man (actually women) appeared within the last 200,000 years (
12-15), much more recently than previously thought. Refinements in the measurements lowered the original estimates to 135,000 years (
15) and finally 100,000 years (
16). Scientists chose to examine
mtDNA because, being enclosed within the subcellular organelle called the
mitochondrion, there is no genetic recombination (males make no contribution of
mtDNA to the fetus). All
mtDNA comes from our mothers and is passed down from mother to daughter, since only
mitochondria from the egg are used to make up the fetus. By tracing the differences in
mtDNA from peoples around the world, scientists have calculated the probable date of the last common ancestor of modern humans at 100,000 to 200,000 years ago.
In 1995, scientists have examined human origins from the perspective of male genetics (
17,
18). Scientists have examined a gene (ZFY), which being on the
Y chromosome, is passed down only from father to son. Thirty-eight men were chosen from all over the world (Africa, Asia, Australia, Europe, and Northern, Central, and South America). Scientists determined the actual genetic
sequence in each man for this gene, which is 729
base pairs long. To their surprise, all men had identical genetic
sequences (over 27,000
base pairs analyzed). Scientists have calculated the most probable date for the last common ancestor of modern man, given the
sequence diversity from modern apes. Using two different models this date is either 270,000 or 27,000 years ago. However, both these models assume that the male population during this entire period of time consisted of only 7,500 individuals. The date estimates from these models would be significantly reduced if the male population were higher than 7,500, which is very likely. Two separate studies using similar techniques looked at larger pieces of the
Y chromosome, which would reduce the uncertainty in the calculation of dates. One study examined a gene which was 2,600
base pairs and determined a last common ancestor date of 188,000 year ago (minimum of 51,000 and maximum of 411,000 years ago) (
19). The other study used a very large piece of the
Y chromosome (18,300
base pairs) and calculated a last common ancestor date of modern man of 43,000 years ago (minimum of 37,000 and maximum of 49,000 years ago) (
16). This latter study also examined
mitochondrial DNA from women and determined an origination date of 90,000-120,000 years ago.
A study published in 1996 (
20) examined
linkage disequilibrium at the human CD4
locus (a T-cell associated antigen) as a means to establish the date of modern human origins. This study determined a maximum origin date of 102,000 years ago based upon the assumption that the
Alu (-)
alleles arose 5 million years ago, or almost immediately after mankind's split from other
primates. As they stated, "It is likely that the
Alu deletion event occurred more recently, in which case our estimates for the date of founding of the non-African populations would also be more recent." Preliminary studies from
chromosomes 19, 11 and 8 show similar results to that seen on
chromosome 12 (the
locus of the CD4 gene) (
21).
Using rare mutations to estimate population divergence times
A study published in 1998 examined population divergence time using rare
mutations between populations to estimate divergence
among three Mediterranean populations. The results indicated that Danish people (who are my ancestors) would have diverged from the other groups, at most, 4,500 to 15,000 years ago (
22). This number does not necessarily help us establish a date for the appearance of modern humans, but it is likely that future studies in this area (this is one of the first published) may provide accurate numbers for the appearance of human populations in different areas of the world and a lower limit to the date of appearance of modern humans.
The nail in the coffin
Therefore, the most accurate date (
see note below) for the origin of modern humans indicate that the last common ancestor to modern humans must have existed less than 50,000 years ago (
16). Such a recent date left only one potential ancestor for modern humans, that is,
Homo neanderthalensis (
Neanderthals), which lived between 400,000 and 28,000 years ago. Previous anatomical studies had cast doubt on the possibility of
Neanderthals being the ancestors of modern humans (
23-
27). These studies showed differences in
Neanderthal's brain case (
23) and the presence of an internal nasal margin, a medial swelling of the lateral nasal wall, and a lack of an
ossified roof over the
lacrimal groove (
24-25). None of these features are found in
Homo sapiens, and the last feature is
not found in any other terrestrial mammal! A recent analysis of
Neanderthal hands has revealed that modern humans and
Neanderthals differed markedly in the kind of grip they could use (
26).
Neanderthals were limited to grips as one has when holding a stone or baseball. Such a grip would have been powerful (you wouldn't want to shake hands with a
Neanderthal), but not very dexterous. The anatomy of the
Neanderthal's hands would have prevented them from engaging in fine motor skills, such as carving and painting. Another study showed that
Neandertals developed much more rapidly than modern humans (or even their own supposed ancestors) (
27), further eroding their possible status as mankind's ancestors. In addition,
Neanderthals had a huge nasal cavity coupled with a brain size larger than our own. However, with their carnivorous lifestyle, it seems likely that much of their brain might have been devoted to the sense of smell, being the "dog" among the
hominids (
28).
In brilliantly designed and executed independent studies, scientists have extracted
mtDNA from four
Neanderthal skeletons; two from Neander Valley in Germany, another from the northern Caucasus near the Black Sea, and the fourth in Vindija Cave, Croatia, and laid to rest any question of whether
Neanderthals could have been our ancestors (
29-
32). The first study examined a 379
base pair Neanderthal mtDNA fragment and compared it with a
mtDNA sequence of 986
nucleotide pairs from living humans of diverse ethnic backgrounds. The results (
Table 1) showed an enormous 26
nucleotide base pair difference between the
Neanderthal and Human
mtDNA (a 6.5% difference) (
29). In this region of the
mtDNA, modern humans differ from one another in an average of eight
base pairs, and those differences were completely independent of the 26 observed for the
Neanderthal fossil. However, many of the
sequence variations found in the
Neanderthals were shared in the
Chimpanzee. A 357
base pair sequence of
mtDNA was examined from the second
Neanderthal fossil and was found to vary from modern human
sequences at 23
bases (6.4%), nineteen of which were identical to those of the first
Neanderthal. The third
Neanderthal differed from modern humans by 26
bases, 23 of which matched the first
Neanderthal and 20 of which matched the second specimen. The fourth
Neandertal differed from modern humans by 23
bases, 22 of which matched the first
Neanderthal, 20 of which matched the second specimen and 23 of which matched the third specimen. A summary of the findings of the two studies can be found in Table 1, below.
Table 1. Sequence Differences* Between Modern Humans and Neanderthals
mtDNA Sample
(HVR1) | Sequence Number (Read Down)
111111111111111111111111111111111
666666666666666666666666666666666
000011111111111112222222222233334
378900112345568880233455667912571
786378129984692399304468238910420 |
|---|
| Modern Human | AATTCCCCGACTGCAATTCACGCAC-CATCCTC |
| Chimpanzee | ......T.ATT.....ACTGAAA....G.... |
| Neandertal #1 | GG.CTTTTATTC.T.CCCTGTAAGTATGCT.CT |
| Neandertal #2 | .C.....ATT.ATCCCCTGTAA.TATGCTTC |
| Neandertal #3 | GG......ATTC.TCCCCTGTAAGTATGCT.C |
| Neandertal #4 | GG......ATTC.TCCCCTGTAA.TATGCT.C |
* mtDNA HVR1 |
The analysis of the second sample was extremely important, since it was dated at 29,000 years ago - only 1000 years before the last
Neanderthal disappeared (
33). If
Neanderthals and humans had interbred, one should have expected to see this in the last remnants of the
Neanderthal's genetics. In addition, since the
Neanderthal fossils were separated geographically by over 2,500 km, it shows that
Neanderthals were a homogeneous species. The researchers conclusion: "
Neanderthals were not our ancestors" - a quote from the authors of the first study. In fact, the differences between modern humans and
Neanderthals were so great that calculations indicated that the last common ancestor (according to evolutionary theory) must have existed 550,000 to 690,000 years ago (first study) and 365,000 to 853,000 years ago (second study).
Although the differences between modern humans and
Neanderthals are large, the differences among individual humans or among individual
Neanderthals is small compared to other apes (
Table 2). Such low genetic diversity among
Neanderthals are consistent with a creation model in which
Neanderthals were specially created as a small population in the relatively recent past. The much larger variation seen among
chimpanzees and gorillas does not eliminate them as specially created, but does place their probable creation date considerably before that of modern humans.
Table 2. mtDNA Sequence Variation (%) Within Species (31)
| Population | Individuals | Mean | Minimum | Maximum | s.d. |
|---|
| Neanderthals | 0,003 | 03.73 | - | - | - |
| Humans | 5,530 | 03.43 | 0.00 | 10.16 | 1.21 |
| Chimpanzees | 0,359 | 14.81 | 0.00 | 29.06 | 5.70 |
| Gorillas | 0,028 | 18.57 | 0.40 | 28.79 | 5.26 |
The final blow to the idea that humans and
Neanderthals interbred was found in a genetic analysis of their
chromosomal DNA, published in 2006-2007 (
34). These results showed that none of the typical SNPs found in modern humans was present in
Neanderthal Y-chromosome DNA.
Ancient Anatomically Modern Humans - the missing evidence
Knowing the variation of
sequences between modern humans and
Neanderthals is important in determining if
Neanderthals contributed to the human gene pool. However, without a measure of the variation among ancient anatomically modern humans and between them and modern humans, the data is incomplete. The first of these studies was published in 2001, examining the
mtDNA sequences of 10 ancient Australians (
35). A summary of the
HVR1 sequence of these individuals (compared with the modern human reference
sequence, modern Aboriginal
polymorphism,
Neanderthals, and
chimpanzees) can be found in
Table 3, below. The first thing that one notices is that the
sequence variation of ancient humans compared to modern humans is at most 10
base pairs (in LM3, the most ancient specimen). As stated previously, the average variation among population groups of modern humans is 8
base pairs. LM3, dated at 40,000 years old (redated from the original estimate of 62,000 years old,
36), varied the most from the modern human reference
sequence, but this variation included only three
bases shared with
Neanderthal specimens. Since LM3 was a contemporary (or lived even earlier than the
Neanderthals sequenced to date), it is apparent that the human
genome was already nearly "modern" before
Neanderthals died out. The authors of the study made a big deal about the LM3
sequence sharing similarity to a portion of
chromosome 11 in modern humans (thought to have been inserted into the human
genome from the
mtDNA). The authors concluded that the "loss" of the ancient
mtDNA variation seen in LM3 could explain how
Neanderthals do not share
mtDNA with modern humans. Although it is certainly possible that part of
mtDNA might find its way into the nuclear
genome, it doesn't address the issue of how the variation seen in the
mtDNA of LM3 was "lost." In fact, of the ten
sequence differences between LM3 and the modern human reference
sequence, five of those
bases correspond to
polymorphisms found in modern Aboriginal people, showing that those five
bases were not lost at all. This leaves only a five
base difference, certainly within the range of that found among modern humans. Overall, the lack of "evolution" for humans over the last 40,000 years stands in sharp contrast to the large differences seen between modern humans and
Neanderthals. European evolutionists have also disputed the claims of Adcock
et al. in the journal
Science in June, 2001. More information on this can be found in the paper,
New DNA Evidence Supports Multiregional Evolutionary Model?
A second study examined the
mtDNA sequences of two Cro-Magnon specimens dated to 23,000 and 25,000 years old (
37). One specimen (Paglicci-25) had no
sequence differences from the modern reference
sequence, and the other (Paglicci-12) only one
substitution (see
Table 3). It is remarkable that so little change in the
sequence had occurred over the last 23,000 years.
Table 3. mtDNA Sequence Variation of Ancient, Anatomically Modern Humans (33)
mtDNA Sample(HVR1) | Age
(ka) | Sequence Number (Read Down)
00111111111111111222222222222222222222222222233333333333333
79001122345668889001223344444555566677888899901112345556688
83781269984393499198340413479368923448467803911780715672817 |
|---|
Modern Human | 0 | ATCCCCTGACTACACTTCTCCTACATGATACACCTCGCACCTCAACTAACCTCTTTTTA |
Aboriginal | 0 | ......CA......TC..CTT...T.....TC..CTA...T.T.G.C..TT.TC.C... |
Bonobo | 0 | ......CAT...T..CCTA.TCGA.CACCAA...C.......AG..CCCT..A.CCC.. |
Chimpanzee | 0 | ....T..ATT.....AA.C.TCGA.CA...A......TG....CG..CT.T.T.C.C.. |
Neanderthal #1 | 40 | GCTTTT.ATTC.T-.CC.C.T.GT..A...AG.T...T......G.C..T.....C... |
LM3 | 40# | ....................T.G...........CT.T....T..T......TC....G |
Paglicci-25 | 23 | ........................................................... |
Paglicci-12 | 25 | ....................T...................................... |
* mtDNA HVR1
#redated from the original 62 ka estimate. |
The ancient Cro-Magnon
mtDNA and modern European
mtDNA differed by only 2-3
base pairs (see
Table 4). This difference is even less than that observed
among modern Europeans! In contrast, these ancient modern humans differed from nearly contemporary
Neandertals by an average of 24
base pairs.
Table 4. mtDNA Sequence Variation Among Modern and Ancient Hominids (37)
| Individual | Modern Europeans | Neandertals |
|---|
| Mean | Min. | Max. | s.d. | Mean | Min. | Max. | s.d. |
|---|
| Paglicci-25 | 2.3 | 0 | 11 | 1.8 | 24.5 | 23 | 28 | 2.4 |
| Paglicci-12 | 3.2 | 0 | 10 | 1.7 | 23.5 | 22 | 27 | 2.4 |
| Modern Europeans | 4.4 | 0 | 18 | 2.3 | - | - | - | - |
According to the authors of the study:
"Although only six HVR1 sequences of ancient a.m.h [anatomically modern humans] and four sequences of Neandertals are available to date, the sharp differentiation among them represents a problem for any model regarding the transition from archaic to modern humans as a process taking place within a single evolving human lineage." (37)
Conclusion 
There are two currently popular theories of human evolution 1) a single recent appearance of modern humans and 2) the
multiregional model, which states that modern humans evolved simultaneously on different continents.
Molecular biology destroys the
multiregional model (
12-
22,
29-
37). In addition, even the fossil evidence does not support the
multiregional model (
38). Instead, all the data supports the biblical view that humanity arose in one geographical locale. Modern
molecular biology tells us that modern humans arose less than 100,000 years ago (confirmed by three independent techniques), and most likely, less than 50,000 years ago (
12-
22). This data ties in quite well with the fossil record. Sophisticated works of art first appear in the fossil record about 40,000-50,000 years ago (
39) and evidence of religious expression appears only 25,000-50,000 years ago (
40,
41). Other indications of rapid changes during the Middle-Upper Paleolithic transition (35,000 to 45,000 years ago) in Europe include (
42):
- A shift in stone tool technology from predominantly "Rake" technologies to "blade" technologies, achieved by means of more economic techniques of core preparation.
- A simultaneous increase in the variety and complexity of stone tools involving more standardization of shape and a higher degree of "imposed form" in the various stages of production.
- The appearance of relatively complex and extensively shaped bone, antler, and ivory artifacts.
- An increase in the rate of technological change accompanied by increased regional diversification of tool, forms.
- The appearance of beads, pendants, and other personal ornaments made from teeth, shell, bone, stone, and ivory blanks.
- The appearance of sophisticated and highly complex forms of representational or "naturalistic" art.
- Associated changes in the socioeconomic organization of human groups, marked by
- a more specialized pattern of animal exploitation, based on systematic hunting
- a sharp increase in the overall density of human population
- an increase in the maximum size of local residential groups
- the appearance of more highly "structured" sites, including more evidence for hearths, pits, huts, tents, and other habitations.
Simultaneous, rapid changes in human abilities suggest replacement of previously existing
hominids with modern humans. The fact that all these events happened ~50,000 years ago precludes any possibility that previously existing
hominids could be our ancestors, since
Homo erectus died out 300,000 years ago, and
Homo neanderthalensis has been proven to be too genetically different from us to have been our ancestor (
29,
30). Where does this leave the evolutionists and their descent of man theory? Well, they can always fall back on their favorite line - "the fossil record is just incomplete." Alternatively, check out
Genesis 1:26.
References
- R. Lewontin 1972. The apportionment of human diversity. Evolutionary Biology 6: 381-398
- M. Nei and A. K. Roychoudhury. 1982. Genetic relationship and evolution of human races. Evolutionary Biology 14: 1-59
- Janczewski DN. Goldman D. O'Brien SJ. 1990. Molecular genetic divergence of orangutan (Pongo pygmaeus) subspecies based on isozyme and two-dimensional gel electrophoresis. Journal of Heredity 81: 375-387
- Gibbons, A. 1995. The mystery of humanity's missing mutations. Science 267: 35-36.
- Pult I, Sajantila A, Simanainen J, Georgiev O, Schaffner W, Paabo S. 1994. Mitochondrial DNA sequences from Switzerland reveal striking homogeneity of European populations. Biol Chem Hoppe Seyler 375: 837-840
- Wood B. 1992. Origin and evolution of the genus Homo. Nature 355: 783-790.
- Shreeve, J. 1996. New skeleton gives path from trees to ground an odd turn. Science 272: 654
- McHenry H.M. 1994. Body size and proportions in early hominids. Proceedings of the National Academy of Sciences of the United States of America 91: 6780-6786.
- Dean Falk. 1998. Hominid brain evolution: looks can be deceiving. Science 280: 1714
- Conroy, G.C., G.W. Weber, H. Seidler, P.V. Tobias, A. Kane, and B. Brunsden. 1998. Endocranial capacity in an early hominid cranium from Sterkfontein, South Africa. Science 280: 1730-1731.
- Eyre-Walker, A. & Keightley, P. D. 1999. High genomic deleterious mutation rates in hominids. Nature 397, 344-347.
- R.L. Cann, M. Stoneking, A.C. Wilson. 1987. Mitochondrial DNA and human evolution. Nature 325: 31.
- L. Vigilant, M. Stoneking, A.C. Harpending, K. Hawkes, A.C. Wilson. 1991. African populations and the evolution of human mitochondrial DNA. Science 253: 1503.
- M. Hasegawa, S. Horai. 1991. Time of the deepest root for polymorphism in human mitochondrial DNA. J. Mol. Evol. 32: 37.
- Stoneking M, Sherry ST, Redd AJ, Vigilant L. 1992. New approaches to dating suggest a recent age for the human mtDNA ancestor. Philos. Trans. R. Soc. Lond. B Biol. Sci. 337: 167-175.
- Whitfield, L.S., J.E. Suston, and P.N. Goodfellow. 1995. Sequence variation of the human Y chromosome. Nature 378: 379-380.
- S. Paabo. 1995. The Y chromosome and the origin of all of us (men). Science 268: 1141.
- R.L. Dorit, H. Akashi, W. Gilbert. 1995. Absence of polymorphism at the ZFY locus on the human Y chromosome. Science 268: 1183.
- Hammer, M.F. 1995. A recent common ancestry for human Y Chromosomes. Nature 378: 376-378.
- Tishkoff, S.A., E. Dietzsch, W. Speed, A.J. Pakstis, J.R. Kidd, K. Cheung, B. Bonn-Tamir, A.S. Santachiara-Benerecetti, P. Moral, M. Krings, S. Paabo, E. Watson, N. Risch, T. Jenkins, and K.K. Kidd. 1996. Global patterns of linkage disequilibrium at the CD4 locus and modern human origins. Science 271: 1380-1387.
- Fischman, J. 1996. Evidence mounts for our African origins - and alternatives. Science 271: 1364.
- G. and B. Rannala. 1998. Using rare mutations to estimate population divergence times: A maximum likelihood approach. Proceedings of the National Academy of Science USA 95: 15452-15457.
- Seidler H, Falk D, Stringer C, Wilfing H, Muller GB, zur Nedden D, Weber GW, Reicheis W, and Arsuaga JL. 1997. A comparative study of stereolithographically modeled skulls of Petralona and Broken Hill: implications for future studies of middle Pleistocene hominid evolution. J. Hum. Evol. 33:691-703.
- Schwartz, J.A. and I. Tattersall. 1996. Significance of some previously unaccompanied apomorphies in the nasal region of Homo neanderthalensis. Proceedings of the National Academy of Science USA 93: 10852-10854.
- Laitman, J.T., J.S. Reidenberg, S. Marquez, and P. J. Gannon. 1996. What the nose knows: New understandings of Neanderthal upper respiratory tract specializations. Proceedings of the National Academy of Science USA 93: 10543-10545.
- Clarke, T. 2001. Relics: Early modern humans won hand over fist. Nature.
Niewoehner, W. A. 2001. Behavioral inferences from the Skhul/Qafzeh early modern human hand remains. Proceedings of the National Academy of Sciences.
- Ramirez, F. V., R. and J. Maria Bermudez de Castro. 2004. Surprisingly rapid growth in Neanderthals. Nature 428: 936-939 doi:10.1038/nature02428.
- Holden, C. 1999. A New Look Into Neandertals' Noses. Science 285: 31-33.
- Krings, M., A. Stone, R. W. Schmitz, H. Krainitzki, M. Stoneking, and S. Paabo. 1997. Neandertal DNA Sequences and the Origin of Modern Humans. Cell 90: 19-30.
- Ovchinnikov, I.V., A. Gotherstrom, G. P. Romanovak, V. M. Kharitonov, K. Liden, and W. Goodwin. 2000. Molecular analysis of Neanderthal DNA from the northern Caucasus. Nature 404: 490-493.
- Krings, M., C. Capelli, F. Tschentscher, H. Geisert, S. Meyer, A. von Haeseler, K. Grossschmidt, G. Possnert, M. Paunovic, and S. P��bo. 2000. A view of Neandertal genetic diversity Nature Genetics 26: 144-146.
- Schmitz, R. W., Serre, D., Bonani, G., Feine, S., Hillgruber, F., Krainitzki, H., P��bo, S. & Smith, F. H. 2002. The Neandertal type site revisited: Interdisciplinary investigations of skeletal remains from the Neander Valley, Germany. Proceedings of the National Academy of Science USA 99: 13342-13347
- Stringer, C. B. and R. Mackie. 1996. African Exodus: the Origin of Modern Humanity. Cape, London.
- Pennisi, E. 2007. ANCIENT DNA: No Sex Please, We're Neandertals. Science 316: 967.
- Adcock, G.J., E.S. Dennis, S. Easteal, G.A. Huttley, L.S. Jermiin, W.J. Peacock, and A. Thorne. 2001. Mitochondrial DNA sequences in ancient Australians: Implications for modern human origins. Proceedings of the National Academy of Science USA 98: 537-542
- Bowler, J. M., Johnston, H., Olley, J. M., Prescott, J. R., Roberts, R. G., Shawcross, W., and Spooner, N. A. 2003. New ages for human occupation and climatic change at Lake Mungo, Australia. Nature 421: 837-840.
- Caramelli, D., C. Lalueza-Fox, C. Vernesi, M. Lari, A. Casoli, F. Mallegnii, B. Chiarelli, I. Dupanloup, J. Bertranpetit, G. Barbujani, and G. Bertorelle. 2003. Evidence for a genetic discontinuity between Neandertals and 24,000-year-old anatomically modern Europeans. Proceedings of the National Academy of Science USA 100: 6593-6597.
- Foley R. 1998. The context of human genetic evolution. Genome Res 8:339-347.
- Klein, R.G. 1992. Evolutionary Anthropology 1: 5-14.
Balter, M. 1999. Restorers reveal 28,000-year-old artworks. Science 283: 1835.
- Simon, C. 1981. Stone-age sanctuary, oldest known shrine, discovered in Spain. Science News 120: 357.
- Bower, B. 1986. When the human spirit soared. Science News 130: 378-379.
- Clark, G.A. 1999. Highly visible, curiously intangible. Science 283: 2029-2032.
- Then God said, "Let Us make man in Our image, according to Our likeness; and let them rule over the fish of the sea and over the birds of the sky and over the cattle and over all the earth, and over every creeping thing that creeps on the earth." (Genesis 1:26)
Note:The 50,000 year date is the best estimate for modern human origins because the study used a much larger
nucleotide base pair sample size, resulting in a much less uncertainty in the date generated (see the table below for further explanation).
| 95% confidence interval | |
|---|
| Study | Model | # base pairs | # men | Total base pairs | Lower | Upper | Mean | Male population size |
|---|
| Dorit, et al. | Coalescent | 729 | 38 | 27702 | 0 | 800,000 | 270,000 | 7,500 |
| Dorit, et al. | Star phylogeny | 729 | 38 | 27702 | 0 | 80,000 | 27,000 | 7,500 |
| Hammer | Coalescent | 2,600 | 15 | 39,000 | 51,000 | 411,000 | 188,000 | 5,000 |
| Whitfield, et al. | Coalescent | 18,300 | 5 | 91,500 | 37,000 | 49,000 | 43,000 | not given |
The estimate of modern origins is highly dependent upon the assumed population size (last column of table). The first study assumed a male population size of 7,500 individuals for the entire period of humanity (excluding the last couple thousand years, of course). Such a population size, according to the authors, is "an exceedingly small population size for this entire 300,000 year period" (16). However, such as small population size was necessary to make the
coalescence time as large as it was. Hammer used an even smaller population size (5,000), since he was concerned that his study would not be accepted if the
coalescence time was too small (which he admitted to doing in Internet dialogs). The first two studies (Dorit, et al. and Hammer) have very large
confidence intervals, due to the small number of
nucleotide base pairs analyzed. Given the size of the
confidence intervals in the first two studies, the numbers from all three studies are basically the same. Obviously, the Whitfield, et al. gives the most precise estimate of the date for the appearance of modern humans.
http://www.godandscience.org/evolution/descent.html
0 comments:
Post a Comment