Pro Creation Resources

Descent of Man from Primates disproved by Molecular Biology

2011-10-15T23:01:00.000-07:00

The following article is a great victory for me personally because it explains on a genetic level how primates could not develop into human beings and Neanderthals cannot be related to human beings. It has some great charts showing the differences in the DNA.

Descent of Mankind Theory: Disproved by Molecular Biology
by Rich Deem

Introduction

The current theory of human evolution states that modern humans evolved from more primitive bipedal hominids. The first bipedal hominid genus that is supposedly the ancestor of modern humans is A genus of extinct hominids, characterized by being the earliest bipedal primate (up to 3.7 million years ago).Australopithecus, which appeared in the fossil record from about 4.4 to 1 million years ago throughout eastern Africa. A genus of extinct hominids, characterized by being the earliest bipedal primate (up to 3.7 million years ago).Australopithecus comprised a diverse group of small-brained bipedal species that were confined to the savannas of Africa. This genus was supposed to have evolved into the genus A genus within the subfamily Homininae that includes modern humans and related species (e.g., Homo habilis, Homo erectus, Homo ergaster, and Homo sapiens).Homo, which has been defined as bipedal primates with a brain capacity over 700 cc, having appeared in the fossil record by about 2.5 million years ago as An extinct species of the genus Homo, which lived approximately 2.5 million to 1.6 million years ago.Homo habilis in eastern Africa. According to theory, An extinct species of the genus Homo, which lived approximately 2.5 million to 1.6 million years ago.Homo habilis evolved into An extinct species of the genus Homo, which appeared approximately 1.8 million years ago.Homo erectus, which had a brain capacity just over 1000 cc, appearing in the fossil record from about 1.8 million to 300 thousand years ago. An extinct species of the genus Homo, also known as Neanderthal (or Neandertal) man, which appeared approximately 400,000 years ago.Homo neanderthalensis lived between 400 and 28 thousand years ago. Archaic The only surviving hominid species, comprising modern human beings and characterized as being a bipedal primate with a large brain capacity, capable of language and the ability to make and use complex tools.Homo sapiens appeared 400 - 150 thousand years ago, and modern The only surviving hominid species, comprising modern human beings and characterized as being a bipedal primate with a large brain capacity, capable of language and the ability to make and use complex tools.Homo sapiens from less than 100 thousand years ago. Contrary to the claims of many creationists, there is ample evidence for the existence of human-like species of bipedal primates. The dates and ages of these fossils are not widely disputed in scientific circles. The reality of the fossil record and the reliability of the dates of these fossils is actually instrumental in disproving the descent of man theory. If the fossil record were not as complete as it now is, the standard evolutionist argument would apply, "we just haven't found the missing link ancestor of modern humans yet."

The beginning of trouble - lack of genetic diversity among modern humans

As evolutionists studied humans and species of apes in the 1970's and 1980's, some rather surprising information was being discovered that distinguished us from apes and other primates. The maximum Fst value (a measure of variation between population groups) between human races is 0.08 (1, 2). However, among populations of chimpanzees, orangutans, and other primate species, Fst values are commonly more than 0.20. An examination of 62 common protein coding genetic loci, indicates a substitution rate of 0.011/locus (Caucasoids versus Mongoloids), to a maximum of 0.029 (Mongoloids versus Negroids). However, in nearly all other animal species studied, including apes, usually exceed 0.05 (2). In humans, heterozygosity (the proportion of alleles that are polymorphic, in this case within the species) is 1.8% , whereas in apes it ranges from 2.5 in the Orangutan to 3.9 in the Chimpanzee (3). An analysis of the genetics of populations of apes reveals that different population groups possess fixed novel mutations that characterize each population. In contrast, there are no novel mutations or genetic alleles that specifically characterize any one human race from another. More recent studies have confirmed the early work, likewise showing that human genetic diversity is far less than what one would predict from Darwinian theory. Dr. Maryellen Ruvolo (Harvard University) has noted, "It's a mystery none of us can explain." (4). Examinations of the genetic sequences of diverse modern human populations reveals minor, if any differences (5). All of this evidence suggested a recent origin for modern humans.

Still more trouble - Discontinuous morphological changes in the A member of the biological family Hominidae, which includes all the "great apes," - extinct and extant humans, chimpanzees, gorillas, and orangutans.hominid lineage

Paleontological discoveries and geochronology show that the pattern of morphological change in the hominid fossil record was not progressive, but abrupt (6). Some adaptations essential to bipedalism appeared early, but others appeared much later. Although the 3.2 million year old fossil "Lucy" (A species of extinct hominid, living 3.9-2.9 million years ago, made famous by the skeleton "Lucy."Australopithecus aferensis), was said to be bipedal, her 2.6 million year old descendent, A species of extinct hominid, living 3-2 million years ago, made famous by the skeletons "Taung Child" and "Mrs. Ples."Australopithecus africanus, was indisputably arboreal (7). Primitive craniodental complexes (similar to the reconstructed last common ancestor with the African great apes) were found in nearly all species of Hominidae (8). Relative brain size increased slightly among successively younger species of Australopithecines, although many Australopithecine skulls have brain capacities no larger than those of chimpanzees. (9, 10). However, brain capacities expanded abruptly with the appearance of A genus within the subfamily Homininae that includes modern humans and related species (e.g., Homo habilis, Homo erectus, Homo ergaster, and Homo sapiens).Homo, but within early A genus within the subfamily Homininae that includes modern humans and related species (e.g., Homo habilis, Homo erectus, Homo ergaster, and Homo sapiens).Homo remained at about half the size of The only surviving hominid species, comprising modern human beings and characterized as being a bipedal primate with a large brain capacity, capable of language and the ability to make and use complex tools.Homo sapiens for almost a million years. The fossil record indicates an accumulation of relatively rapid shifts in successive species, and certainly not any kind of gradualistic changes.

Another problem - too many Having a harmful of bad effect.deleterious Permanent structural alterations in DNA, consisting of either substitutions, insertions or deletions of nucleotide bases.mutations

A recent study examined the mutation rate for humans. Using "conservative assumptions" the authors found that the overall mutation rates was 4.2 mutations per person per generation, with a deleterious rate of 1.6 (11). When using more realistic assumptions the overall mutation rate for humans become 6.7 with a deleterious rate of 3.1. Such a high rate should have resulted in extinction of our species long ago. They stated in their conclusion:

"The Having a harmful of bad effect.deleterious A permanent structural alteration in DNA, consisting of either a substitution, insertion or deletion of nucleotide bases.mutation rate appears to be so high in humans and our close relatives that it is doubtful that such species, which have low reproductive rates, could survive if Relating to a permanent structural alteration in DNA, consisting of either a substitution, insertion or deletion of nucleotide bases.mutational effects on fitness were to combine in a multiplicative way."

The authors had to rely upon a rare association of mutations, termed synergistic epistasis to explain why the numerous hypothesized deleterious mutations have not overwhelmed our genome. Instead of postulating the obvious (that the human genome is not as old as evolution would teach), evolutionists must rely upon the improbable to retain the evolutionary paradigm.

Recent origin of modern humans confirmed through The branch of science that studies the structure and activity of macromolecules essential to life (and especially related to their genetic role).molecular biology

Of or referring to the mitochondria, the organelles that generate energy for the cell.Mitochondrial Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA (Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA)

In the late 1980's and early 1990's a number of studies were done examining the mitochondrial DNA ( mtDNA) of women all over the world. These studies, nicknamed the "Eve theory," suggested that the last common ancestor of modern man (actually women) appeared within the last 200,000 years (12-15), much more recently than previously thought. Refinements in the measurements lowered the original estimates to 135,000 years (15) and finally 100,000 years (16). Scientists chose to examine mtDNA because, being enclosed within the subcellular organelle called the mitochondrion, there is no genetic recombination (males make no contribution of mtDNA to the fetus). All mtDNA comes from our mothers and is passed down from mother to daughter, since only mitochondria from the egg are used to make up the fetus. By tracing the differences in mtDNA from peoples around the world, scientists have calculated the probable date of the last common ancestor of modern humans at 100,000 to 200,000 years ago.

One of the two sex chromosomes that determines maleness in mammals, carried and passed down from males to males.Y-chromosome analysis

In 1995, scientists have examined human origins from the perspective of male genetics (17, 18). Scientists have examined a gene (ZFY), which being on the Y chromosome, is passed down only from father to son. Thirty-eight men were chosen from all over the world (Africa, Asia, Australia, Europe, and Northern, Central, and South America). Scientists determined the actual genetic sequence in each man for this gene, which is 729 base pairs long. To their surprise, all men had identical genetic sequences (over 27,000 base pairs analyzed). Scientists have calculated the most probable date for the last common ancestor of modern man, given the sequence diversity from modern apes. Using two different models this date is either 270,000 or 27,000 years ago. However, both these models assume that the male population during this entire period of time consisted of only 7,500 individuals. The date estimates from these models would be significantly reduced if the male population were higher than 7,500, which is very likely. Two separate studies using similar techniques looked at larger pieces of the Y chromosome, which would reduce the uncertainty in the calculation of dates. One study examined a gene which was 2,600 base pairs and determined a last common ancestor date of 188,000 year ago (minimum of 51,000 and maximum of 411,000 years ago) (19). The other study used a very large piece of the Y chromosome (18,300 base pairs) and calculated a last common ancestor date of modern man of 43,000 years ago (minimum of 37,000 and maximum of 49,000 years ago) (16). This latter study also examined mitochondrial DNA from women and determined an origination date of 90,000-120,000 years ago.

The non-random association of alleles at two or more genetic loci, in which combinations of alleles or genetic markers occur more or less frequently in a population than would be expected from a random formation of haplotypes from alleles based on their frequencies.Linkage disequilibrium analysis

A study published in 1996 (20) examined linkage disequilibrium at the human CD4 locus (a T-cell associated antigen) as a means to establish the date of modern human origins. This study determined a maximum origin date of 102,000 years ago based upon the assumption that the Alu (-) alleles arose 5 million years ago, or almost immediately after mankind's split from other primates. As they stated, "It is likely that the Alu deletion event occurred more recently, in which case our estimates for the date of founding of the non-African populations would also be more recent." Preliminary studies from chromosomes 19, 11 and 8 show similar results to that seen on chromosome 12 (the locus of the CD4 gene) (21).

Using rare mutations to estimate population divergence times

A study published in 1998 examined population divergence time using rare mutations between populations to estimate divergenceamong three Mediterranean populations. The results indicated that Danish people (who are my ancestors) would have diverged from the other groups, at most, 4,500 to 15,000 years ago (22). This number does not necessarily help us establish a date for the appearance of modern humans, but it is likely that future studies in this area (this is one of the first published) may provide accurate numbers for the appearance of human populations in different areas of the world and a lower limit to the date of appearance of modern humans.

The nail in the coffin

Therefore, the most accurate date (see note below) for the origin of modern humans indicate that the last common ancestor to modern humans must have existed less than 50,000 years ago (16). Such a recent date left only one potential ancestor for modern humans, that is, An extinct species of the genus Homo, also known as Neanderthal (or Neandertal) man, which appeared approximately 400,000 years ago.Homo neanderthalensis (Neanderthals), which lived between 400,000 and 28,000 years ago. Previous anatomical studies had cast doubt on the possibility of Neanderthals being the ancestors of modern humans (23-27). These studies showed differences in Neanderthal's brain case (23) and the presence of an internal nasal margin, a medial swelling of the lateral nasal wall, and a lack of an ossified roof over the lacrimal groove (24-25). None of these features are found in The only surviving hominid species, comprising modern human beings and characterized as being a bipedal primate with a large brain capacity, capable of language and the ability to make and use complex tools.Homo sapiens, and the last feature is not found in any other terrestrial mammal! A recent analysis of Neanderthal hands has revealed that modern humans and Neanderthals differed markedly in the kind of grip they could use (26). Neanderthals were limited to grips as one has when holding a stone or baseball. Such a grip would have been powerful (you wouldn't want to shake hands with a Neanderthal), but not very dexterous. The anatomy of the Neanderthal's hands would have prevented them from engaging in fine motor skills, such as carving and painting. Another study showed that Neandertals developed much more rapidly than modern humans (or even their own supposed ancestors) (27), further eroding their possible status as mankind's ancestors. In addition, Neanderthals had a huge nasal cavity coupled with a brain size larger than our own. However, with their carnivorous lifestyle, it seems likely that much of their brain might have been devoted to the sense of smell, being the "dog" among the hominids (28).
In brilliantly designed and executed independent studies, scientists have extracted mtDNA from four Neanderthal skeletons; two from Neander Valley in Germany, another from the northern Caucasus near the Black Sea, and the fourth in Vindija Cave, Croatia, and laid to rest any question of whether Neanderthals could have been our ancestors (29-32). The first study examined a 379 base pair Neanderthal mtDNA fragment and compared it with a mtDNA sequence of 986 nucleotide pairs from living humans of diverse ethnic backgrounds. The results (Table 1) showed an enormous 26 nucleotide base pair difference between the Neanderthal and Human mtDNA (a 6.5% difference) (29). In this region of the mtDNA, modern humans differ from one another in an average of eight base pairs, and those differences were completely independent of the 26 observed for the Neanderthal fossil. However, many of the sequence variations found in the Neanderthals were shared in the Chimpanzee. A 357 base pair sequence of mtDNA was examined from the second Neanderthal fossil and was found to vary from modern human sequences at 23 bases (6.4%), nineteen of which were identical to those of the first Neanderthal. The third Neanderthal differed from modern humans by 26 bases, 23 of which matched the first Neanderthal and 20 of which matched the second specimen. The fourth Neandertal differed from modern humans by 23 bases, 22 of which matched the first Neanderthal, 20 of which matched the second specimen and 23 of which matched the third specimen. A summary of the findings of the two studies can be found in Table 1, below.

Table 1. The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.Sequence Differences* Between Modern Humans and An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals
Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA Sample (Hypervariable region 1 of the D-loop of mitochondrial DNA, which ranges from nucleotide positions 16001-16570.HVR1)	Sequence Number (Read Down) 111111111111111111111111111111111 666666666666666666666666666666666 000011111111111112222222222233334 378900112345568880233455667912571 786378129984692399304468238910420
Modern Human	AATTCCCCGACTGCAATTCACGCAC-CATCCTC
Two living species of ape in the genus Pan, including Pan troglodytes, the Common Chimpanzee, and Pan paniscust, also known as Bonobo or Pygmy Chimpanzee.Chimpanzee	......T.ATT.....ACTGAAA....G....
An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertal #1	GG.CTTTTATTC.T.CCCTGTAAGTATGCT.CT
An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertal #2	.C.....ATT.ATCCCCTGTAA.TATGCTTC
An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertal #3	GG......ATTC.TCCCCTGTAAGTATGCT.C
An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertal #4	GG......ATTC.TCCCCTGTAA.TATGCT.C

* mtDNA HVR1

The analysis of the second sample was extremely important, since it was dated at 29,000 years ago - only 1000 years before the last Neanderthal disappeared (33). If Neanderthals and humans had interbred, one should have expected to see this in the last remnants of the Neanderthal's genetics. In addition, since the Neanderthal fossils were separated geographically by over 2,500 km, it shows that Neanderthals were a homogeneous species. The researchers conclusion: "Neanderthals were not our ancestors" - a quote from the authors of the first study. In fact, the differences between modern humans and Neanderthals were so great that calculations indicated that the last common ancestor (according to evolutionary theory) must have existed 550,000 to 690,000 years ago (first study) and 365,000 to 853,000 years ago (second study).
Although the differences between modern humans and Neanderthals are large, the differences among individual humans or among individual Neanderthals is small compared to other apes (Table 2). Such low genetic diversity among Neanderthals are consistent with a creation model in which Neanderthals were specially created as a small population in the relatively recent past. The much larger variation seen among chimpanzees and gorillas does not eliminate them as specially created, but does place their probable creation date considerably before that of modern humans.

Table 2. Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.Sequence Variation (%) Within Species (31)
Population	Individuals	Mean	Minimum	Maximum	s.d.
An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals	0,003	03.73	-	-	-
Humans	5,530	03.43	0.00	10.16	1.21
Chimpanzees	0,359	14.81	0.00	29.06	5.70
Gorillas	0,028	18.57	0.40	28.79	5.26

The final blow to the idea that humans and Neanderthals interbred was found in a genetic analysis of their chromosomal DNA, published in 2006-2007 (34). These results showed that none of the typical SNPs found in modern humans was present in Neanderthal Y-chromosome DNA.

Ancient Anatomically Modern Humans - the missing evidence

Knowing the variation of sequences between modern humans and Neanderthals is important in determining if Neanderthals contributed to the human gene pool. However, without a measure of the variation among ancient anatomically modern humans and between them and modern humans, the data is incomplete. The first of these studies was published in 2001, examining the mtDNA sequences of 10 ancient Australians (35). A summary of the HVR1 sequence of these individuals (compared with the modern human reference sequence, modern Aboriginal polymorphism, Neanderthals, and chimpanzees) can be found in Table 3, below. The first thing that one notices is that the sequence variation of ancient humans compared to modern humans is at most 10 base pairs (in LM3, the most ancient specimen). As stated previously, the average variation among population groups of modern humans is 8 base pairs. LM3, dated at 40,000 years old (redated from the original estimate of 62,000 years old, 36), varied the most from the modern human reference sequence, but this variation included only three bases shared with Neanderthal specimens. Since LM3 was a contemporary (or lived even earlier than the Neanderthals sequenced to date), it is apparent that the human genome was already nearly "modern" before Neanderthals died out. The authors of the study made a big deal about the LM3 sequence sharing similarity to a portion of chromosome 11 in modern humans (thought to have been inserted into the human genome from the mtDNA). The authors concluded that the "loss" of the ancient mtDNA variation seen in LM3 could explain how Neanderthals do not share mtDNA with modern humans. Although it is certainly possible that part of mtDNA might find its way into the nuclear genome, it doesn't address the issue of how the variation seen in the mtDNA of LM3 was "lost." In fact, of the ten sequence differences between LM3 and the modern human reference sequence, five of those bases correspond to polymorphisms found in modern Aboriginal people, showing that those five bases were not lost at all. This leaves only a five base difference, certainly within the range of that found among modern humans. Overall, the lack of "evolution" for humans over the last 40,000 years stands in sharp contrast to the large differences seen between modern humans and Neanderthals. European evolutionists have also disputed the claims of Adcock et al. in the journal Science in June, 2001. More information on this can be found in the paper, New DNA Evidence Supports Multiregional Evolutionary Model?
A second study examined the mtDNA sequences of two Cro-Magnon specimens dated to 23,000 and 25,000 years old (37). One specimen (Paglicci-25) had no sequence differences from the modern reference sequence, and the other (Paglicci-12) only one substitution (see Table 3). It is remarkable that so little change in the sequence had occurred over the last 23,000 years.

Table 3. Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.Sequence Variation of Ancient, Anatomically Modern Humans (33)
Genetic material found in mitochondria, the organelles that generate energy for the cell.`mtDNA` `Sample`(Hypervariable region 1 of the D-loop of mitochondrial DNA, which ranges from nucleotide positions 16001-16570.`HVR1`)	`Age (ka)`	`Sequence Number (Read Down)` `00111111111111111222222222222222222222222222233333333333333 79001122345668889001223344444555566677888899901112345556688 83781269984393499198340413479368923448467803911780715672817`
`Modern Human`	`0`	`ATCCCCTGACTACACTTCTCCTACATGATACACCTCGCACCTCAACTAACCTCTTTTTA`
`Aboriginal`	`0`	`......CA......TC..CTT...T.....TC..CTA...T.T.G.C..TT.TC.C...`
The common name for Pan paniscust, also known as the Pygmy Chimpanzee.`Bonobo`	`0`	`......CAT...T..CCTA.TCGA.CACCAA...C.......AG..CCCT..A.CCC..`
Two living species of ape in the genus Pan, including Pan troglodytes, the Common Chimpanzee, and Pan paniscust, also known as Bonobo or Pygmy Chimpanzee.`Chimpanzee`	`0`	`....T..ATT.....AA.C.TCGA.CA...A......TG....CG..CT.T.T.C.C..`
An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.`Neanderthal` `#1`	`40`	`GCTTTT.ATTC.T-.CC.C.T.GT..A...AG.T...T......G.C..T.....C...`
`LM3`	`40#`	`....................T.G...........CT.T....T..T......TC....G`
`Paglicci-25`	`23`	`...........................................................`
`Paglicci-12`	`25`	`....................T......................................`

* mtDNA HVR1
#redated from the original 62 ka estimate.

The ancient Cro-Magnon mtDNA and modern European mtDNA differed by only 2-3 base pairs (see Table 4). This difference is even less than that observed among modern Europeans! In contrast, these ancient modern humans differed from nearly contemporary Neandertals by an average of 24 base pairs.

Table 4. Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.Sequence Variation Among Modern and Ancient Members of the biological family Hominidae, which includes all the "great apes," - extinct and extant humans, chimpanzees, gorillas, and orangutans.Hominids (37)
Individual	Modern Europeans				An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertals
Individual	Mean	Min.	Max.	s.d.	Mean	Min.	Max.	s.d.
Paglicci-25	2.3	0	11	1.8	24.5	23	28	2.4
Paglicci-12	3.2	0	10	1.7	23.5	22	27	2.4
Modern Europeans	4.4	0	18	2.3	-	-	-	-

According to the authors of the study:

"Although only six Hypervariable region 1 of the D-loop of mitochondrial DNA, which ranges from nucleotide positions 16001-16570.HVR1 The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences of ancient a.m.h [anatomically modern humans] and four The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences of An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertals are available to date, the sharp differentiation among them represents a problem for any model regarding the transition from archaic to modern humans as a process taking place within a single evolving human lineage." (37)

Conclusion

There are two currently popular theories of human evolution 1) a single recent appearance of modern humans and 2) the multiregional model, which states that modern humans evolved simultaneously on different continents. Molecular biology destroys the multiregional model (12-22, 29-37). In addition, even the fossil evidence does not support the multiregional model (38). Instead, all the data supports the biblical view that humanity arose in one geographical locale. Modern molecular biology tells us that modern humans arose less than 100,000 years ago (confirmed by three independent techniques), and most likely, less than 50,000 years ago (12-22). This data ties in quite well with the fossil record. Sophisticated works of art first appear in the fossil record about 40,000-50,000 years ago (39) and evidence of religious expression appears only 25,000-50,000 years ago (40, 41). Other indications of rapid changes during the Middle-Upper Paleolithic transition (35,000 to 45,000 years ago) in Europe include (42):

A shift in stone tool technology from predominantly "Rake" technologies to "blade" technologies, achieved by means of more economic techniques of core preparation.
A simultaneous increase in the variety and complexity of stone tools involving more standardization of shape and a higher degree of "imposed form" in the various stages of production.
The appearance of relatively complex and extensively shaped bone, antler, and ivory artifacts.
An increase in the rate of technological change accompanied by increased regional diversification of tool, forms.
The appearance of beads, pendants, and other personal ornaments made from teeth, shell, bone, stone, and ivory blanks.
The appearance of sophisticated and highly complex forms of representational or "naturalistic" art.
Associated changes in the socioeconomic organization of human groups, marked by
- a more specialized pattern of animal exploitation, based on systematic hunting
- a sharp increase in the overall density of human population
- an increase in the maximum size of local residential groups
- the appearance of more highly "structured" sites, including more evidence for hearths, pits, huts, tents, and other habitations.

Simultaneous, rapid changes in human abilities suggest replacement of previously existing hominids with modern humans. The fact that all these events happened ~50,000 years ago precludes any possibility that previously existing hominids could be our ancestors, since An extinct species of the genus Homo, which appeared approximately 1.8 million years ago.Homo erectus died out 300,000 years ago, and An extinct species of the genus Homo, also known as Neanderthal (or Neandertal) man, which appeared approximately 400,000 years ago.Homo neanderthalensis has been proven to be too genetically different from us to have been our ancestor (29, 30). Where does this leave the evolutionists and their descent of man theory? Well, they can always fall back on their favorite line - "the fossil record is just incomplete." Alternatively, check out Genesis 1:26.

References

R. Lewontin 1972. The apportionment of human diversity. Evolutionary Biology 6: 381-398
M. Nei and A. K. Roychoudhury. 1982. Genetic relationship and evolution of human races. Evolutionary Biology 14: 1-59
Janczewski DN. Goldman D. O'Brien SJ. 1990. Molecular genetic divergence of An arboreal great ape belonging to the genus Pongo, consisting of two species, Pongo pygmaeus of Borneo and Pongo abelii, characterized by a reddish-brown coat, very long arms, and no tail.orangutan (Pongo pygmaeus) subspecies based on isozyme and two-dimensional gel electrophoresis. Journal of Heredity 81: 375-387
Gibbons, A. 1995. The mystery of humanity's missing Permanent structural alterations in DNA, consisting of either substitutions, insertions or deletions of nucleotide bases.mutations. Science 267: 35-36.
Pult I, Sajantila A, Simanainen J, Georgiev O, Schaffner W, Paabo S. 1994. Of or referring to the mitochondria, the organelles that generate energy for the cell.Mitochondrial Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences from Switzerland reveal striking homogeneity of European populations. Biol Chem Hoppe Seyler 375: 837-840
Wood B. 1992. Origin and evolution of the The second smallest classification name given for each biological species. Each genu can be comprised of one or more species.genus A genus within the subfamily Homininae that includes modern humans and related species (e.g., Homo habilis, Homo erectus, Homo ergaster, and Homo sapiens).Homo. Nature 355: 783-790.
Shreeve, J. 1996. New skeleton gives path from trees to ground an odd turn. Science 272: 654
McHenry H.M. 1994. Body size and proportions in early Members of the biological family Hominidae, which includes all the "great apes," - extinct and extant humans, chimpanzees, gorillas, and orangutans.hominids. Proceedings of the National Academy of Sciences of the United States of America 91: 6780-6786.
Dean Falk. 1998. A member of the biological family Hominidae, which includes all the "great apes," - extinct and extant humans, chimpanzees, gorillas, and orangutans.Hominid brain evolution: looks can be deceiving. Science 280: 1714
Conroy, G.C., G.W. Weber, H. Seidler, P.V. Tobias, A. Kane, and B. Brunsden. 1998. Endocranial capacity in an early A member of the biological family Hominidae, which includes all the "great apes," - extinct and extant humans, chimpanzees, gorillas, and orangutans.hominid cranium from Sterkfontein, South Africa. Science 280: 1730-1731.
Eyre-Walker, A. & Keightley, P. D. 1999. High genomic Having a harmful of bad effect.deleterious A permanent structural alteration in DNA, consisting of either a substitution, insertion or deletion of nucleotide bases.mutation rates in Members of the biological family Hominidae, which includes all the "great apes," - extinct and extant humans, chimpanzees, gorillas, and orangutans.hominids. Nature 397, 344-347.
R.L. Cann, M. Stoneking, A.C. Wilson. 1987. Of or referring to the mitochondria, the organelles that generate energy for the cell.Mitochondrial Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA and human evolution. Nature 325: 31.
L. Vigilant, M. Stoneking, A.C. Harpending, K. Hawkes, A.C. Wilson. 1991. African populations and the evolution of human Of or referring to the mitochondria, the organelles that generate energy for the cell.mitochondrial Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA. Science 253: 1503.
M. Hasegawa, S. Horai. 1991. Time of the deepest root for A common variation in the sequence of DNA among individuals of a species or race.polymorphism in human Of or referring to the mitochondria, the organelles that generate energy for the cell.mitochondrial Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA. J. Mol. Evol. 32: 37.
Stoneking M, Sherry ST, Redd AJ, Vigilant L. 1992. New approaches to dating suggest a recent age for the human Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA ancestor. Philos. Trans. R. Soc. Lond. B Biol. Sci. 337: 167-175.
Whitfield, L.S., J.E. Suston, and P.N. Goodfellow. 1995. The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.Sequence variation of the human One of the two sex chromosomes that determines maleness in mammals, carried and passed down from males to males.Y chromosome. Nature 378: 379-380.
S. Paabo. 1995. The One of the two sex chromosomes that determines maleness in mammals, carried and passed down from males to males.Y chromosome and the origin of all of us (men). Science 268: 1141.
R.L. Dorit, H. Akashi, W. Gilbert. 1995. Absence of A common variation in the sequence of DNA among individuals of a species or race.polymorphism at the ZFY The place on a chromosome where a specific gene is located, a kind of address for the gene.locus on the human One of the two sex chromosomes that determines maleness in mammals, carried and passed down from males to males.Y chromosome. Science 268: 1183.
Hammer, M.F. 1995. A recent common ancestry for human One of the two sex chromosomes that determines maleness in mammals, carried and passed down from males to males.Y Chromosomes. Nature 378: 376-378.
Tishkoff, S.A., E. Dietzsch, W. Speed, A.J. Pakstis, J.R. Kidd, K. Cheung, B. Bonn-Tamir, A.S. Santachiara-Benerecetti, P. Moral, M. Krings, S. Paabo, E. Watson, N. Risch, T. Jenkins, and K.K. Kidd. 1996. Global patterns of The association of genes and/or markers that lie near each other on a chromosome that tend to be inherited together.linkage The non-random association of alleles at two or more genetic loci, in which combinations of alleles or genetic markers occur more or less frequently in a population than would be expected from a random formation of haplotypes from alleles based on their frequencies.disequilibrium at the CD4 The place on a chromosome where a specific gene is located, a kind of address for the gene.locus and modern human origins. Science 271: 1380-1387.
Fischman, J. 1996. Evidence mounts for our African origins - and alternatives. Science 271: 1364.
G. and B. Rannala. 1998. Using rare Permanent structural alterations in DNA, consisting of either substitutions, insertions or deletions of nucleotide bases.mutations to estimate population divergence times: A maximum likelihood approach. Proceedings of the National Academy of Science USA 95: 15452-15457.
Seidler H, Falk D, Stringer C, Wilfing H, Muller GB, zur Nedden D, Weber GW, Reicheis W, and Arsuaga JL. 1997. A comparative study of stereolithographically modeled skulls of Petralona and Broken Hill: implications for future studies of middle The epoch from 1.8 million to 10,000 years year ago, covering the world's recent period of repeated glaciations.Pleistocene A member of the biological family Hominidae, which includes all the "great apes," - extinct and extant humans, chimpanzees, gorillas, and orangutans.hominid evolution. J. Hum. Evol. 33:691-703.
Schwartz, J.A. and I. Tattersall. 1996. Significance of some previously unaccompanied apomorphies in the nasal region of An extinct species of the genus Homo, also known as Neanderthal (or Neandertal) man, which appeared approximately 400,000 years ago.Homo neanderthalensis. Proceedings of the National Academy of Science USA 93: 10852-10854.
Laitman, J.T., J.S. Reidenberg, S. Marquez, and P. J. Gannon. 1996. What the nose knows: New understandings of An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal upper respiratory tract specializations. Proceedings of the National Academy of Science USA 93: 10543-10545.
Clarke, T. 2001. Relics: Early modern humans won hand over fist. Nature.
Niewoehner, W. A. 2001. Behavioral inferences from the Skhul/Qafzeh early modern human hand remains. Proceedings of the National Academy of Sciences.
Ramirez, F. V., R. and J. Maria Bermudez de Castro. 2004. Surprisingly rapid growth in An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals. Nature 428: 936-939 doi:10.1038/nature02428.
Holden, C. 1999. A New Look Into An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertals' Noses. Science 285: 31-33.
Krings, M., A. Stone, R. W. Schmitz, H. Krainitzki, M. Stoneking, and S. Paabo. 1997. An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertal Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA Sequences and the Origin of Modern Humans. Cell 90: 19-30.
Ovchinnikov, I.V., A. Gotherstrom, G. P. Romanovak, V. M. Kharitonov, K. Liden, and W. Goodwin. 2000. Molecular analysis of An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA from the northern Caucasus. Nature 404: 490-493.
Krings, M., C. Capelli, F. Tschentscher, H. Geisert, S. Meyer, A. von Haeseler, K. Grossschmidt, G. Possnert, M. Paunovic, and S. Pï¿½ï¿½bo. 2000. A view of An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertal genetic diversity Nature Genetics 26: 144-146.
Schmitz, R. W., Serre, D., Bonani, G., Feine, S., Hillgruber, F., Krainitzki, H., Pï¿½ï¿½bo, S. & Smith, F. H. 2002. The An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertal type site revisited: Interdisciplinary investigations of skeletal remains from the Neander Valley, Germany. Proceedings of the National Academy of Science USA 99: 13342-13347
Stringer, C. B. and R. Mackie. 1996. African Exodus: the Origin of Modern Humanity. Cape, London.
Pennisi, E. 2007. ANCIENT Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA: No Sex Please, We're An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertals. Science 316: 967.
Adcock, G.J., E.S. Dennis, S. Easteal, G.A. Huttley, L.S. Jermiin, W.J. Peacock, and A. Thorne. 2001. Of or referring to the mitochondria, the organelles that generate energy for the cell.Mitochondrial Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences in ancient Australians: Implications for modern human origins. Proceedings of the National Academy of Science USA 98: 537-542
Bowler, J. M., Johnston, H., Olley, J. M., Prescott, J. R., Roberts, R. G., Shawcross, W., and Spooner, N. A. 2003. New ages for human occupation and climatic change at Lake Mungo, Australia. Nature 421: 837-840.
Caramelli, D., C. Lalueza-Fox, C. Vernesi, M. Lari, A. Casoli, F. Mallegnii, B. Chiarelli, I. Dupanloup, J. Bertranpetit, G. Barbujani, and G. Bertorelle. 2003. Evidence for a genetic discontinuity between An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertals and 24,000-year-old anatomically modern Europeans. Proceedings of the National Academy of Science USA 100: 6593-6597.
Foley R. 1998. The context of human genetic evolution. Genome Res 8:339-347.
Klein, R.G. 1992. Evolutionary Anthropology 1: 5-14.
Balter, M. 1999. Restorers reveal 28,000-year-old artworks. Science 283: 1835.
Simon, C. 1981. Stone-age sanctuary, oldest known shrine, discovered in Spain. Science News 120: 357.
Bower, B. 1986. When the human spirit soared. Science News 130: 378-379.
Clark, G.A. 1999. Highly visible, curiously intangible. Science 283: 2029-2032.
Then God said, "Let Us make man in Our image, according to Our likeness; and let them rule over the fish of the sea and over the birds of the sky and over the cattle and over all the earth, and over every creeping thing that creeps on the earth." (Genesis 1:26)

Note:The 50,000 year date is the best estimate for modern human origins because the study used a much larger nucleotide base pair sample size, resulting in a much less uncertainty in the date generated (see the table below for further explanation).


Study	Model	# Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pairs	# men	Total Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pairs	Lower	Upper	Mean	Male population size
					95% confidence interval
Dorit, et al.	Relating to the mathematical and statistical properties of genealogies. A modelling framework in which two DNA sequence lineages converge in a common ancestral sequence, going backwards in time.Coalescent	729	38	27702	0	800,000	270,000	7,500
Dorit, et al.	A mathematical and statistical model in which each individual is derived independently from the original ancestor.Star phylogeny	729	38	27702	0	80,000	27,000	7,500
Hammer	Relating to the mathematical and statistical properties of genealogies. A modelling framework in which two DNA sequence lineages converge in a common ancestral sequence, going backwards in time.Coalescent	2,600	15	39,000	51,000	411,000	188,000	5,000
Whitfield, et al.	Relating to the mathematical and statistical properties of genealogies. A modelling framework in which two DNA sequence lineages converge in a common ancestral sequence, going backwards in time.Coalescent	18,300	5	91,500	37,000	49,000	43,000	not given

The estimate of modern origins is highly dependent upon the assumed population size (last column of table). The first study assumed a male population size of 7,500 individuals for the entire period of humanity (excluding the last couple thousand years, of course). Such a population size, according to the authors, is "an exceedingly small population size for this entire 300,000 year period" (16). However, such as small population size was necessary to make the coalescence time as large as it was. Hammer used an even smaller population size (5,000), since he was concerned that his study would not be accepted if the coalescence time was too small (which he admitted to doing in Internet dialogs). The first two studies (Dorit, et al. and Hammer) have very large confidence intervals, due to the small number of nucleotide base pairs analyzed. Given the size of the confidence intervals in the first two studies, the numbers from all three studies are basically the same. Obviously, the Whitfield, et al. gives the most precise estimate of the date for the appearance of modern humans.

http://www.godandscience.org/evolution/descent.html

Hunter-gatherers vs. an early civilized world

2011-10-02T21:29:00.000-07:00

The finding of Gobekli Tepe shows that man could create complicated structures much earlier in this world than previously thought. Elementary school children are taught that men were hunter-gatherers who wandered the continents and finally settled down when agriculture was invented. Then they had pastoral communities. However, the Bible states the shepherding and agriculture existed right after Eden.

Genesis 4:1 says "Now Abel was a keeper of the sheep but Cain was a tiller of the soil." These were the sons of Adam. This happened right after the Garden of Eden. Evolutionists think that man is getting smarter but the truth is Adam was a genius created by God so his children could do great things. Look what Cain did after he was cursed by God- Genesis 4:15 "Cain went out from the presence of the Lord and dwelt in the land of Nod east of Eden." So they knew where Eden was. It wasn't something that disappeared when Adam sinned There was a geographical region called "Nod." So Cain got a wife (his sister or niece or grand-niece) and built a city for his son Enoch (this is not the Enoch who was called up to heaven by God). It doesn't say a village of grass huts but a city.

Cain had one descendant named Jabal who was the father of those who lives in tents and have livestock. This seems to the opposite of the hunter-gather theory. Jabal had a brother Jubal. He was the father of those who play the harp and flute indicating that musical instruments existed at that time. The third brother was Tubal-Cain who heated metal and shaped it. These men were 6 generations out from Adam!

Below is a video showing how a model was made for Gobekli Tepe, and may help one imagine how these men from the Bible could be at such a location. There is a lot of commentary about how it is the birthplace of religion, when the plan of salvation was given in Eden, but try to look at this as being created by men who came from Cain, a man who left the presence of the Lord. The History Channel has a video for this and wonders why the inhabitants covered it in 20 feet of sand but that could have been done by the Flood. Gaines Johnson suggests that the Flood was a gentle enough to allow structures to continue standing afterwards.

http://ngm.nationalgeographic.com/2011/06/gobekli-tepe/modeling-gobekli-video

Hunter-gatherer myth vs. Bible statements

2011-10-02T20:04:00.000-07:00

The finding of the Gobekli Tepe structure demonstrates that men could create complicated buildings at an early time in this earth. Elementary school children are taught that man was originally a hunter-gatherer who came up from Africa and after many thousands of years settled down and farmed and built cities.

2011-09-22T18:42:00.000-07:00

Gobekli Tepe

Below is an article about Gobekli Tepe, a Stonehenge like place of amazing and great proportions that was discovered in Turkey in 1994 by a Kurdish shepherd. According to the current dating techniques, these structures are 10,000 to 12,000 years old. I am including this article in my blog on the Gap Theory because it is necessary to decide if these structures came before or after the Gap. It is pretty obvious that they came after the Gap but were they before the Flood? Most of the Young Earth creationists and Gap Theory creationists like to place the creation of Adam as being 6,000 plus years ago, but a archeological find like this changes things. Possibly this structure belonged to those sons of God of Genesis 6, those fallen angels who could be seen by humans. They had children with women of earth and great heroes were born. However, this was a threat to the purity of the line of Christ, for he could not save us as a man if mankind's DNA was mixed with angel DNA. So the Lord brought the Flood upon the Earth, and Noah and his family who were pure human survived.

Read more: http://www.dailymail.co.uk/sciencetech/article-1157784/Do-mysterious-stones-mark-site-Garden-Eden.html#ixzz1YjcDiAdl

And another article:

World's First Temple	Volume 61 Number 6, November/December 2008
by Sandra Scham

Turkey's 12,000-year-old stone circles were the spiritual center of a nomadic people

It is likely the megaliths at the Neolithic site of Göbekli Tepe in Turkey once supported roofs. Archaeologists have found floors constructed of burnt lime and clay within the stone circles--the earliest such floors ever discovered. (Haldun Aydingün)

Hunter-gatherers used stone tools to create images of male creatures on T-shaped pillars. Most of the carvings show dangerous animals, such as this lion. (Klaus Schmidt)

At first glance, the fox on the surface of the limestone pillar appears to be a trick of the bright sunlight. But as I move closer to the large, T-shaped megalith, I find it is carved with an improbable menagerie. A bull and a crane join the fox in an animal parade etched across the surface of the pillar, one of dozens erected by early Neolithic people at Göbekli Tepe in southeastern Turkey. The press here is fond of calling the site "the Turkish Stonehenge," but the comparison hardly does justice to this 25-acre arrangement of at least seven stone circles. The first structures at Göbekli Tepe were built as early as 10,000 B.C., predating their famous British counterpart by about 7,000 years.
The oldest man-made place of worship yet discovered, Göbekli Tepe is "one of the most important monuments in the world," says Hassan Karabulut, associate curator of the nearby Urfa Museum. He and archaeologist Zerrin Ekdogan of the Turkish Ministry of Culture guide me around the site. Their enthusiasm for the ancient temple is palpable.
By the time of my visit in late summer, the excavation team lead by Klaus Schmidt of the German Archaeological Institute has wrapped up work for the season. But there is still plenty to see, including three excavated circles now protected by a large metal shelter. The megaliths, which may have once supported roofs, are about nine feet tall.
Göbekli Tepe's circles range from 30 to 100 feet in diameter and are surrounded by rectangular stone walls about six feet high. Many of the pillars are carved with elaborate animal figure reliefs. In addition to bulls, foxes, and cranes, representations of lions, ducks, scorpions, ants, spiders, and snakes appear on the pillars. Freestanding sculptures depicting the animals have also been found within the circles. During the most recent excavation season, archaeologists uncovered a statue of a human and sculptures of a vulture's head and a boar.
As we walk around the recently excavated pillars, the site seems at once familiar and exotic. I have seen stone circles before, but none like these.


Left to right: T-shaped pillars at Göbekli Tepe depict two boars accompanied by ostrich-like birds, a crocodile-like creature, and vultures flying above a scorpion. (Haldun Aydingün)

Excavations have revealed that Göbekli Tepe was constructed in two stages. The oldest structures belong to what archaeologists call the early Pre-Pottery Neolithic A period, which ended around 9000 B.C. Strangely enough, the later remains, which date to the Pre-Pottery Neolithic B period, or about 8000 B.C., are less elaborate. The earliest levels contain most of the T-shaped pillars and animal sculptures.
Archaeologist Klaus Schmidt downplays extravagant spiritual interpretations of Göbekli Tepe, such as the idea, made popular in the press, that the site is the inspiration for the Biblical Garden of Eden. But he does agree that it was a sanctuary of profound significance in the Neolithic world. He sees it as a key site in understanding the transition from hunting and gathering to agriculture, and from tribal to regional religion.
Schmidt and his colleagues estimate that at least 500 people were required to hew the 10- to 50-ton stone pillars from local quarries, move them from as far as a quarter-mile away, and erect them. How did Stone Age people achieve the level of organization necessary to do this? Hauptmann speculates that an elite class of religious leaders supervised the work and later controlled the rituals that took place at the site. If so, this would be the oldest known evidence for a priestly caste--much earlier than when social distinctions became evident at other Near Eastern sites.

Klaus Schmidt of the German Archaeological Institute believes Göbekli Tepe attracted small nomadic groups from numerous regions throughout southeastern Anatolia. (Haldun Aydingün)

Before the discovery of Göbekli Tepe, archaeologists believed that societies in the early Neolithic were organized into small bands of hunter-gatherers and that the first complex religious practices were developed by groups that had already mastered agriculture. Scholars thought that the earliest monumental architecture was possible only after agriculture provided Neolithic people with food surpluses, freeing them from a constant focus on day-to-day survival. A site of unbelievable artistry and intricate detail, Göbekli Tepe has turned this theory on its head.
Schmidt believes the people who created these massive and enigmatic structures came from great distances. It seems certain that once pilgrims reached Göbekli Tepe, they made animal sacrifices. Schmidt and his team have found the bones of wild animals, including gazelles, red deer, boars, goats, sheep, and oxen, plus a dozen different bird species, such as vultures and ducks, scattered around the site. Most of these animals are depicted in the sculptures and reliefs at the site.
There is still much that we don't understand about religious practices at Göbekli Tepe, Schmidt cautions. But broadly speaking, the animal images "probably illustrate stories of hunter-gatherer religion and beliefs," he says, "though we don't know at the moment." The sculptors of Göbekli Tepe may have simply wanted to depict the animals they saw, or perhaps create symbolic representations of the animals to use in rituals to ensure hunting success.
Schmidt has another theory about how Göbekli Tepe became a sacred place. Though he has yet to find them, he believes that the first stone circles on the hill of the navel marked graves of important people. Hauptmann's team discovered graves at Nevali Cori, and Schmidt is reasonably confident that burials lie somewhere in the earliest layers of Göbekli Tepe. This leads him to suspect the pillars represent human beings and that the cult practices at this site may initially have focused on some sort of ancestor worship. The T-shaped pillars, he points out, look like human bodies with the upper part of the "T" resembling a head in profile. Once, Schmidt says, they stood on the hillside "like a meeting of stone beings."

Sandra Scham is ARCHAEOLOGY's Washington, D.C., correspondent and a fellow at the American Association for the Advancement of Science.

Analysis of Neanderthal Article

2011-07-31T18:15:00.000-07:00

The evolutionist seeks to to use all data to prove their point. They have discovered that Neanderthals are different from Homo Sapiens so now they must come up with a hypothesis of what happened to them. The following article suggests that Homo Sapiens came up from Africa in great droves and took over the land from the Neatherthals because of superior mental abilities. The Bible says modern man has superior mental ability because he was created that way. The evolutionist must think in terms of continuous development from swamp scum to modern man. Fossil and DNA are proving to show little pockets of ancient creatures who have no relation to Homo Sapiens . The Neanderthals were not made in the image of God and did not have his ability to use tools and socially interact. They went extinct as the earth went into turmoil over the rebellion of Satan. The stopped and Adam started. There is not an overlap of civilizations.

http://www.sciencedaily.com/releases/2011/07/
110728144928.htm

Fall of the Neanderthals: Volume of Modern Humans Infiltrating Europe

Map of the migration of modern man out of Africa. Triangles represent Aurignacian (considered the first modern humans) split-base points. (Credit: Dora Kemp, McDonald Institute for Archaeological Research)ScienceDaily (July 29, 2011) — New research sheds light on why, after 300,000 years of domination, European Neanderthals abruptly disappeared. Researchers from the University of Cambridge have discovered that modern humans coming from Africa swarmed the region, arriving with over ten times the population as the Neanderthal inhabitants.

The reasons for the relatively sudden disappearance of the European Neanderthal populations across the continent around 40,000 years ago has for long remained one of the great mysteries of human evolution. After 300 millennia of living, and evidently flourishing, in the cold, sub-glacial environments of central and western Europe, they were rapidly replaced over all areas of the continent by new, anatomically and genetically 'modern' (i.e. Homo sapiens) populations who had originated and evolved in the vastly different tropical environments of Africa.

The most plausible answer to this long-debated question has now been published in the journal Science by two researchers from the Department of Archaeology at Cambridge -- Professor Sir Paul Mellars, Professor Emeritus of Prehistory and Human Evolution, and Jennifer French, a second-year PhD student.

By conducting a detailed statistical analysis of the archaeological evidence from the classic 'Perigord' region of southwestern France, which contains the largest concentration of Neanderthal and early modern human sites in Europe, they have found clear evidence that the earliest modern human populations penetrated the region in at least ten times larger numbers than those of the local Neanderthal populations already established in the same regions. This is reflected in a sharp increase in the total number of occupied sites, much higher densities of occupation residues (i.e. stone tools and animal food remains) in the sites, and bigger areas of occupation in the sites, revealing the formation of much larger and apparently more socially integrated social groupings.

Faced with this dramatic increase in the incoming modern human population, the capacity of the local Neanderthal groups to compete for the same range of living sites, the same range of animal food supplies (principally reindeer, horse, bison and red deer), and the same scarce fuel supplies to tide the groups over the extremely harsh glacial winters, would have been massively undermined. Additionally, almost inevitably, repeated conflicts or confrontations between the two populations would arise for occupation of the most attractive locations and richest food supplies, in which the increased numbers and more highly coordinated activities of the modern human groups would ensure their success over the Neanderthal groups.

The archaeological evidence also strongly suggests that the incoming modern groups possessed superior hunting technologies and equipment (e.g. more effective and long-range hunting spears), and probably more efficient procedures for processing and storing food supplies over the prolonged and exceptionally cold glacial winters. They also appear to have had more wide-ranging social contacts with adjacent human groups to allow for trade and exchange of essential food supplies in times of food scarcity.

Whether the incoming modern human groups also possessed more highly developed brains and associated mental capacities than the Neanderthals remains at present a matter of intense debate. But the sudden appearance of a wide range of complex and sophisticated art forms (including cave paintings), the large-scale production of elaborate decorative items (such as perforated stone and ivory beads, and imported sea shells), and clearly 'symbolic' systems of markings on bone and ivory tools -- all entirely lacking among the preceding Neanderthals -- strongly point to more elaborate systems of social communications among the modern groups, probably accompanied by more advanced and complex forms of language.

All of these new and more complex behavioural patterns can be shown to have developed first among the ancestral African Homo sapiens populations, at least 20,0000 to 30,000 years before their dispersal from Africa, and progressive colonisation (and replacement of earlier populations) across all regions of Europe and Asia from around 60,000 years onwards.

If, as the latest genetic evidence strongly suggests, the African Homo sapiens and European Neanderthal populations had been evolving separately for at least half a million years, then the emergence of some significant contrasts in the mental capacities of the two lineages would not be a particularly surprising development, in evolutionary terms.

Professor Sir Paul Mellars, Professor Emeritus of Prehistory and Human Evolution at the Department of Archaeology, said: "In any event, it was clearly this range of new technological and behavioural innovations which allowed the modern human populations to invade and survive in much larger population numbers than those of the preceding Neanderthals across the whole of the European continent. Faced with this kind of competition, the Neanderthals seem to have retreated initially into more marginal and less attractive regions of the continent and eventually -- within a space of at most a few thousand years -- for their populations to have declined to extinction -- perhaps accelerated further by sudden climatic deterioration across the continent around 40,000 years ago."

Whatever the precise cultural, behavioural and intellectual contrasts between the Neanderthals and intrusive modern human populations, this new study published in Science demonstrates for the first time the massive numerical supremacy of the earliest modern human populations in western Europe, compared with those of the preceding Neanderthals, and thereby largely resolves one of the most controversial and long-running debates over the rapid decline and extinction of the enigmatic Neanderthal population.
--------------------------------------------------------------------------------

Story Source:

The above story is reprinted (with editorial adaptations by ScienceDaily staff) from materials provided by University of Cambridge.

--------------------------------------------------------------------------------

Journal Reference:

P. Mellars, J. C. French. Tenfold Population Increase in Western Europe at the Neandertal-to-Modern Human Transition. Science, 2011; 333 (6042): 623 DOI: 10.1126/science.1206930
Need to cite this story in your essay, paper, or report? Use one of the following formats:
APA

MLA
University of Cambridge (2011, July 29). Fall of the Neanderthals: Volume of modern humans infiltrating Europe cited as critical factor. ScienceDaily. Retrieved July 31, 2011, from http://www.sciencedaily.com /releases/2011/07/110728144928.htm
Note: If no author is given, the source is cited instead.

Disclaimer: Views expressed in this article do not necessarily reflect those of ScienceDaily or its staff.

Young Carbon in Old Rocks

2011-05-30T08:51:00.000-07:00

I referred this article to my GAP theory and geology expert, Gaines Johnson and he said that it is fantastic news." From a Biblical Perspective, it casts doubt on any life here on Earth prior to the Cambrian explosion. "

My own interpretation is that God may have put life forms on the Earth during the time that Satan was in power. He said he "willl ascend into the heavens" so that means he was down somewhere, maybe on Earth.

Isaiah 14:12-17 states: " How you are fallen from heaven, O Lucifer, son of the morning! [How] you are cut down to the ground, You who weakened the nations! For you have said in your heart: 'I will ascend into heaven, I will exalt my throne above the stars of God; I will also sit on the mount of the congregation On the farthest sides of the north; I will ascend above the heights of the clouds, I will be like the Most High.' Yet you shall be brought down to Sheol, To the lowest depths of the Pit. "Those who see you will gaze at you, [And] consider you, [saying:] '[Is] this the man who made the earth tremble, Who shook kingdoms, Who made the world as a wilderness And destroyed its cities, [Who] did not open the house of his prisoners?' New King James Version

ScienceDaily (May 21, 2011) — Carbon found within ancient rocks has played a crucial role developing a time line for the emergence of biological life on the planet billions of years ago. But applying cutting-edge technology to samples of ancient rocks from northern Canada has revealed the carbon-based minerals may be much younger than the rock they inhabit, a team of researchers report in the latest edition of the journal Nature Geoscience.

The team -- which includes researchers from Boston College, the Carnegie Institution of Washington, NASA's Johnson Space Center and the Naval Research Laboratory -- says new evidence from Canada's Hudson Bay region shows carbonaceous particles are millions of years younger than the rock in which they're found, pointing to the likelihood that the carbon was mixed in with the metamorphic rock later than the rock's earliest formation -- estimated to be 3.8 to 4.2 billion years ago.

The samples come from the Nuvvuagittuq Supracrustal Belt, a sedimentary banded iron formation located in the Archean Superior craton, one of Earth's ancient continental shields. Samples were subjected to a range of high-tech tests in an effort to more clearly characterize the carbon in the rock.

Traditional techniques used by scientists have involved collecting samples and crushing them into powder and then determining the bulk characteristics of carbon minerals. The new approach relies upon a variety of microscopy and spectroscopy methods to characterize intact micro-fabricated cross-sections of crystalline graphite removed from the rock samples. The results found that the carbon was very young compared to the age of these oldest rock samples ever unearthed.

"The characteristics of the poorly crystalline graphite within the samples are not consistent with the metamorphic history of the rock," said Boston College Assistant Professor of Earth and Environmental Sciences Dominic Papineau, a co-author of the report. "The carbon in the graphite is not as old as the rock. That can only ring a bell and require us to ask if we need to reconsider earlier studies."

Nearly 4,000-million years old samples from Greenland have been used to develop the dominant time line regarding the emergence of the earliest biosphere. The recent findings suggest the biosphere may have emerged millions of years later, a hypothesis that now demands a rigorous study, said Papineau.

"It could be that researchers in the field need to go back to Greenland to restudy these rocks and determine if the the carbonaceous materials are in fact as old as the metamorphosed rock itself," Papineau said.

As the planet evolved, rock and other matter was subjected to a range of temperatures that leave telltale signatures scientists can now study. The team's examination found that the rock samples were subjected to high-grade metamorphism. Yet the crystalline structure of the graphite present in the samples was not, leading scientists to conclude the matter infiltrated the rock at a later stage in time, though the exact timing is not clear at this point.

The presence of carbon and the specific characteristics of that carbon's source material are crucial to understanding the evolution of the early microbial biosphere. The subject of much debate within scientific circles, a new set of assumptions may be required when using the presence of carbon to date milestones in Earth's evolution.

"We can no longer assume that carbon is indigenous in the oldest metamorphosed sedimentary rock," said Papineau. "In very old rocks, the fundamental questions are now whether the carbon is biological in origin and if it is indigenous to the rocks."

Funding organizations for this work included the NASA Exobiology and Evolutionary Biology Program, Carnegie of Canada, the Geophysical Laboratory of the Carnegie Institution of Washington, the Keck Foundation and the Fond Québécois pour la recherche sur la nature et les technologies

Gap Theory presented by Fred Williamson of Landmark Missionary Church

2011-03-27T19:20:00.000-07:00

This excellent article comes out of the American Baptist Convention, from Landmark Missionary Church in Lakewood, Colorado.
http://www.landmark-lakewood.org/index.php

The Gap Theory of Creation
By Bro Fred Stevenson

GENESIS 1:1

"In the beginning God created the heaven and the earth" (Genesis 1:1).

The writer does not accept the common teaching of Darwin’s Theory of Evolution. I believe in another theory called the Gap Theory. The creation of Genesis 1:1 was not the same creation in Genesis 1:3. I believe that the conditions listed here were the result of Lucifer and angels who followed him into the casting down from heaven of the participants.

The commentary will be directed toward these beliefs and the Bible will be the main source of information used. I must add right here that the idea of commenting on the Bible is awe-inspiring. In actual fact, the Bible comments upon itself and it would be presumptuous of me to try to help the Bible to say what it says. My goal is to comment on some ideas that will be helpful in understanding the flow of the Word of God, the harmony of its many teachings, particularly on the things it says about our common beginnings. God certainly does not need my help in the Scriptures, buy my prayer is that some of the thoughts that will be presented will be helpful to some who would search the riches of the Scriptures on these matters.

A literal translation of this verse begins with "In beginning." The article "the" is not in the Hebrew. This is partially due to the fact that the addition of the article is a way of bringing the thought of the Hebrew into the English. The two languages are constructed differently and to smooth out the transition from one language to another some things are added or taken away to have the same basic thought in both languages.

There is, however, a different thought that should be considered as well. When Moses spoke of beginning here, there was only one beginning he could have listed. Simply put, there was only one beginning. Before Genesis 1:1, God existed and God only. There were not several beginnings. In that one and only beginning, God created. Had there been other beginnings God wanted us to consider, and then Moses would have been inspired to point to that specific beginning God wanted him to discuss in this context.

The word translated "beginning" here is significant. It has the idea of the firstling, the very first of things. The thought is that in the beginning, and it was an unprecedented beginning, something took place that had never been before. It is difficult to put the whole of the thought into words without being redundant. God inspired Moses to write in words that draw a line between what existed before this, only Himself, and those things that existed afterwards. Before this, nothing existed other than God Himself. No, not angels, demons, plant life, animal life, nothing existed but God.

The word translated God here is "Elohim." It is most often translated into the English as God. There are a few instances where it is "angels." Sometimes it is "gods" referring to idols and false gods. Almost without exception, especially in the Old Testament when the letters "el" begin or end a word, this is a reference to God. Names had meaning in the Old Testament. Elijah means My God is Jehovah. Elisha means My God is Salvation. Daniel means My God is Judge. The word "Bethel" is seen often in the Old and New Testament and means "House of God."

The word, "elohim" means "strong ones." It is a plural word, referring to more than two. This is a teaching of the Trinity, at least three "strong ones," God the Father, God the Son, and God the Holy Spirit." God is omnipotent, meaning, "all-powerful." There is no power that equals God's, thus, Elohim recognizes this characteristic of God. It is important that we come to the realization that God and only God has powers to create. Often we hear someone praised for their creative talents, but in actual fact, only God can create. We have many who are capable of taking something that appears to have no value and making from it a thing of beauty or desirability. That is not creating, it is making. This is an important distinction to remember as we go along in this study; it will be discussed more and more.

CREATION

The Biblical account of creation is undoubtedly the most controversial issue in the Bible over the past 125 to 150 years. Men generally doubt the Bible based on their feeling that a creation as taught in Genesis is impossible. Also, the Genesis account covers events that had their beginning about 6,000 years ago and there have been many things "proven" to be more than 6,000 years old

The practice of this commentary will be to list the Hebrew and Greek words only when it is felt they are needed to make the point needed. I will begin with the word translated "created." The Hebrew word is "bara." "Bara" carries the idea that God brought into existence something that had not existed prior to that moment. A good way of stating this would be that He, from His own essence spoke and a new form came into being. In Genesis 1:7, the statement is made that He "made" and that word in Hebrew is "assah." It has the implication that a new thing was made from something that already existed. In other places, the Hebrew word, "yasar" is used. It's meaning is the idea of not only making something from pre-existing matter, but to fashion, or to form somewhat like an artist, or like a potter fashions clay.

It is not possible to read Genesis and get a complete, or even partial picture of what the Bible has to say of the works of God. The Bible must be studied as one work, not sixty-six little books. The Bible, while written by about thirty-nine or forty writers, is God's Word and it all must be taken into account. Now, in Genesis, we learn that God created the heavens and the earth, that is beyond question. What did God use in this act of creation? Let us seek an answer, at least a partial answer to that question. It is a reasonable question and God did provide us an answer in Psalms 33:6-9,

By the word of the LORD were the heavens made; and all the host of them by the breath of his mouth. He gathereth the waters of the sea together as an heap: he layeth up the depth in storehouses. Let all the earth fear the LORD: let all the inhabitants of the world stand in awe of him. For he spake, and it was done; he commanded, and it stood fast.

The fact is that God not only created the world, He laid out the foundation Himself. Psalms 104:5 "Who laid the foundations of the earth, that it should not be removed for ever." It is foolish of "educated" men to try to explain that this creation is the result of a series of timely accidents. It just doesn't make sense that an atom could become attracted to another atom, then these atoms join with others in a sequence that left them floating in a perfect orbit around the sun with the moon in an orbit around the earth and thus, the sun in such a well orchestrated fashion. No, this was not what happened. Genesis 1:1 gives us the description of the true events.

THE CREATOR - GOD

Genesis 1:1 says that God was the creator and, certainly we will not try to change that in any way. To do so would violate the principles of Bible interpretation just as seriously as those who deny it. However, let us look at an interesting fact of that creation. God, as we said earlier is translated from the word Elohim, which refers to a triune, or a plural look at the Godhead. We say that God is a Trinity; He is Deity. He is Father, Son and Holy Spirit.

So, now let us appeal to Scripture for the participants in creation. God and God alone created the heavens and the earth, yet all three of His manifestations were involved in it.

Colossians 1:16,17 "For by him were all things created, that are in heaven, and that are in earth, visible and invisible, whether they be thrones, or dominions, or principalities, or powers: all things were created by him, and for him: And he is before all things, and by him all things consist. "

Jesus is the "Him" referred to in this passage. While He limited Himself to a great degree while in His personal ministry here on earth, His powers are beyond our wildest imagination. God, the Son of God, later to become God in flesh, was the one who physically performed the acts of creation. He took the ideas and plans that God the Father thought up, drew up, so to speak and physically put them into being.

God the Father, God the Son were in the creation, where does the Holy Spirit fit in this? He is the life giver in the holy Trinity. It was He who conceived Jesus in the womb of the virgin Mary. It is He who gives Spiritual eternal life to the lost sinner when he accepts Christ as personal Savior. So, we have the whole of the Trinity of God deeply and intimately involved in the creation.

THE ORDERLY NATURE OF CREATION

It is important for us to see the way God went about the creation. This was no helter-skelter mishmash of throwing things into existence just to see what they looked like. This is about the way the evolutionists would have us believe this universe became what it did.

The order was explicit. He first created the heavens and then the earth. No, this was no gathering together of magnetized atoms in some random fashion, it was placed in a specific place at the right time, and it was His plan. The evolutionist’s ideas would be rather comical if men would simply look at the utter lack of order it suggests. Isn't it rather difficult to really believe that these events just happened at such opportune times? I find that it would take much more faith in a bunch of accidents than it takes to believe and accept that the God of heaven could simply speak and these events come to be. There can be no other explanation that makes logic work out on it. That series of accidents simply doesn't work out, and to believe that God is omnipotent and omniscient enough to know where to put every piece to harmonize with every other piece is much easier.

I have one question for evolutionists and I have never seen a response to this one: Where did those two atoms that were first attracted to each other get their start, where did they come from. That question, at least for me, makes their theories just that, theories with no believable evidence of validity.

What about the things that brought on the "Big Bang?" Where did they come from? An explosion of that magnitude would have to have a substantial amount of "matter" involved, plus some kind of trigger mechanism to cause this matter to explode so violently as is suggested. Did the matter come from nothing, if so, how. If not, explain its beginning or origin.

To accept God as perfect in all His ways and then state that a magnetized attraction of two atoms, or a violent explosion of matter caused this to begin simply is not harmony. God is orderly and organized in everything He does. There is no luck, there are no accidents, at least until sinful man began to mess things up, so this thinking does not work out with the facts we have available to us.

If we will carefully look at the creation account, we see the orderliness of God. There had to be a beginning point, what better than this? The sun rides around in the heavens that God created. It provides light and heat. We know by Scriptures that God is the true light, but He chose the sun to do this work for Him. God uses gravity to hold things in place. It is not a coincidence that the earth revolves in such an exact orbit around the sun, nor that the moon orbits in a systematic orbit around the earth. No, these things fit in their place because an orderly God chose this way for things to be done.

Another question that comes to mind in regard to the idea that a series of fortunate accidents took place is "What would keep these 'accidents' from continuing"? If the symmetry of this universe just happened in a series of chance happenings, can we also expect a series of accidents to cause it to fall apart? Is this evolution idea completed, or will it continue. If we read and depend upon God's Word, we find that He has some future plans for it, based upon man's response to His will. The answer is that when this world, as we know it, comes to an end, it will be at the hand of God. It will not be a nuclear holocaust, it will not be an accident, and it will not be a quirk of nature. God will rain fire down from heaven.

I have heard people talk in worried tones about a great disaster that may be in the future that will destroy the world. That does not bother me in the least. God will destroy the world, not man. It will be the result of His power, not man's.

.... God did these things so that His chosen vessel,man, would his needs met and his existence made possible.

GENESIS 1:2

"And the earth was without form, and void; and darkness was upon the face of the deep. And the Spirit of God moved upon the face of the waters" (Genesis 1:2).

This verse brings us to a place where much controversy becomes a probability. I hasten here to restate the premise for our understanding of God. He is perfect. He is without the ability to do anything less than perfect. There are no degrees of perfection. There can be no possibility of God creating something "more" or "less" perfect. It is either perfect or it is not, there is no almost perfect, somewhat perfect, or perfect and more.

Now, we see that God, just reading verse 2 in Genesis 1 created something that is not perfect. It is said to be "without form and void." I fully accept and understand that God can do anything He has not stated He couldn't do. He very well could have created the universe without form and void, but that simply belies Him.

That same creation, taken without other considerations, was left in total darkness. Again, since God is light, this just doesn't harmonize with what we know of God. So, to try to under-stand that God, the very essence of perfection creating a vast universe that is very far from perfection is not consistent with Scriptural evidence we have about God.

LET'S TRANSLATE FROM THE HEBREW

The Hebrew language does not have the "being" form of the verb. The word translated "was" here is "hayitha." It comes from the root word, "haya." That word is used in Genesis 2:7 where the rendering is that "man became a living soul." The Hebrew Lexicon defines the word as "became" also. With this in view, then we need to state verse 2 to read "And the earth became without form and void." No, it was not created that way; it became that way as the result of some event. We will look for an answer to this puzzle a little later.

The Hebrew word used for "without form" is "tohu" and this really is the best definition for that word. It has the idea of God having created something that was nothing, waste; emptiness is most difficult to believe.

The Hebrew word, "bohu" means waste and emptiness, and void is the best English word we have to use here. In Genesis 1:1, we saw that the word, "create" gave us the idea that God created, took from Himself, from His own essence and spoke to create the world. He put into being something that had never had existence before and that it was His own essence.

Genesis 1:2 further states that "darkness was upon the face of the waters." Again, when looking at the Hebrew word, we find that the darkness discussed in this context has the idea of a total lack of light. The same word is used in Exodus to describe one of the ten plagues upon Egypt. It is a darkness that can be felt; a darkness that light cannot penetrate. God is the light; He did not create the heavens and the earth in darkness.

With this further verification of the lack of usefulness associated with this description of Genesis 1:2, we will now appeal to some additional passages for help in reaching a reasonable conclusion of this discussion. While acknowledging fully the power of God to do whatever He chooses to do, He also reveals to us in His word those things to help steer us to a harmonious conclusion to most, if not all issues. The question here would be "Did God create something that could not support life or not?"

Isaiah 45:18 For thus saith the LORD that created the heavens; God himself that formed the earth and made it; he hath established it, he created it not in vain, he formed it to be inhabited: I am the LORD; and there is none else.

The answer to the question seems to be clear and positive in this verse. God did not create the heavens and the earth void. We saw that the word "tohu" was used in Genesis 1:2 to state the world became void. That same word is used in Isaiah 45:18, let me call your attention to the latter portion of that verse. "...he created it not in vain..." He created it NOT TOHU. That being the case, then the world BECAME tohu.

With the evidence just presented, and other passages, I am ready to reject the idea that God created the heavens and the earth without form and void. Why then, do we find such a condition in existence? I am firmly convinced that there are two passages of Scripture that give us a very clear picture of the events that caused Genesis 1:2. One of those is Ezekiel 28:1-19. The other is Isaiah 14:12-17. This is quoted here:

How art thou fallen from heaven, O Lucifer, son of the morning! how art thou cut down to the ground, which didst weaken the nations! For thou hast said in thine heart, I will ascend into heaven, I will exalt my throne above the stars of God: I will sit also upon the mount of the congregation, in the sides of the north: I will ascend above the heights of the clouds; I will be like the most High. Yet thou shalt be brought down to hell, to the sides of the pit. They that see thee shall narrowly look upon thee, and consider thee, saying, Is this the man that made the earth to tremble, that did shake kingdoms; That made the world as a wilderness, and destroyed the prisoners?

Lucifer was an angel with apparent archangel authority. While the Scriptures call only Michael an archangel, it appears that Lucifer and Gabriel had similar positions in the heavens. Michael had authority over the spirit realm, Gabriel over the intellect or informational realm, and Lucifer over the material realm. It is evident that Lucifer was a creature of magnificent beauty. He undoubtedly was the most beautiful of all the spirit-realm. He also realized this and reveled in that beauty. His ego and pride sought even "greater" things for himself. He made the statements listed in Isaiah 14 from a position of pride and arrogance. Note carefully the five statements beginning "I will." This is the key to understanding what caused the conditions listed in Genesis 1:2.

This statement, "I will be like the most high," would better be rendered "I will replace the most high." No, it was not enough for him to be like God, Lucifer wanted to be God. It seems that he observed the role that the Son played in God's plan and chose to do whatever he could do to take the place of the Son. He realized that the Son would always be God's favorite and that he, the created being could never become God, but he did everything he could to disrupt that plan.

It is somewhat amazing to study this thing and realize that man, especially in our culture today loves the winner. Some claim to support the underdog, but in reality this is rare. So, with that thought in mind, isn't it surprising to see how easily Satan can win people over when he is the biggest loser of all ages? As a result of his "I will" in Isaiah 14, he was cast out of heaven and the realm he was responsible for was destroyed. He tried to become God and was cast out because of that. The resulting impact on the creation, along with the fact that Satan probably threw the greatest temper tantrum of all ages caused the conditions shown in Genesis 1:2. I am convinced that he destroyed the parts that were left intact, if any, just to keep God's plan for His Son and mankind from coming to be. He failed.

As a matter of fact, he failed several more times to achieve this very task. In the garden, he enticed Eve to eat of the fruit of the tree of Knowledge of Good and Evil. He appealed to her in the three ways that separate men from God even today, lust of the eye, "it looks good,” lust of the flesh, "it was good for food," and pride of life, "it will make you like gods, you will know good and evil." In other words, he convinced the woman she would not need God. Ultimately, he was convinced that God would kill them, and the line to Jesus would be cut off. He enticed and enraged Cain to the point that he killed his brother. Satan used this to cut off the line. He, I am sure, felt that Adam would kill Cain in retaliation and this would stop the line to Christ. Seth was born and that took care of that.

At the time of Noah, God repented that He had created man to reach the point of sinfulness he came to. Satan again thought he had been able to put a stop to this by God's resolve to destroy mankind and what he had come to. Again, God had a plan that overcame Satan.

At the time of the birth of Jesus, Satan had been able to use King Herod to have a decree go out that all male children of Israel under two years of age would be killed to destroy this "King of the Jews" Herod wanted to stop. Instead, the Son was taken to the safety of Egypt. Again, Satan was the loser.

Oh, but then came the Cross. I can imagine the glee and the great rejoicing that must have gone on with Satan when Jesus died on Calvary that dark, terrible day. Surely, he must have danced the jig of victory; he had to have felt that at long last he had cut off the Son from the plan God had laid out for Him. I can also see the dance come to an abrupt end when Jesus came from the tomb. Satan must have realized that he was finally and forever doomed to failure. Could there be any way he could not realize this?

Can't you see the utter look of dejection when Jesus uttered the words of Revelation 1:18 "I am he that liveth, and was dead; and, behold, I am alive for evermore, Amen; and have the keys of hell and of death." With His resurrection, whatever claims and control Satan had over hell and death were forever removed from him. Jesus had taken them from him and they were never more to be Satan’s to control.

So, in this brief view of Lucifer, Satan and their treatment at the hands of the Omnipotent God, isn't it a little difficult to understand why so many of the human race are so easily drawn to this loser? He has never won in any contest he has had with God, yet people follow him readily. We are a strange beast aren't we?

So, now we have what I believe to be the Biblical answer to the puzzle created by the description of a creation that was without form and void with darkness upon it. The God we know is perfection in its highest sense. He did not; He could not create something that was without form and void, with darkness upon it. No, the rebellion of Lucifer and a third of the angels of heaven brought their casting down out of heaven. This in itself caused a great amount of destruction. Then, in his savage reaction to his defeat, Lucifer went about a raging destructive tantrum. This caused the "without form and void" conditions shown in Genesis 1:2.

Genesis Chapter 1
1 In the beginning God created the heaven and the earth.
2 And the earth was without form, and void; and darkness was upon the face of the deep. And the Spirit of God moved upon the face of the waters.
3 And God said, Let there be light: and there was light.
4 And God saw the light, that it was good: and God divided the light from the darkness.
5 And God called the light Day, and the darkness he called Night. And the evening and the morning were the first day.
6 And God said, Let there be a firmament in the midst of the waters, and let it divide the waters from the waters.
7 And God made the firmament, and divided the waters which were under the firmament from the waters which were above the firmament: and it was so.
8 And God called the firmament Heaven. And the evening and the morning were the second day.
9 And God said, Let the waters under the heaven be gathered together unto one place, and let the dry land appear: and it was so.
10 And God called the dry land Earth; and the gathering together of the waters called he Seas: and God saw that it was good.
11 And God said, Let the earth bring forth grass, the herb yielding seed, and the fruit tree yielding fruit after his kind, whose seed is in itself, upon the earth: and it was so.
12 And the earth brought forth grass, and herb yielding seed after his kind, and the tree yielding fruit, whose seed was in itself, after his kind: and God saw that it was good.
13 And the evening and the morning were the third day.
14 And God said, Let there be lights in the firmament of the heaven to divide the day from the night; and let them be for signs, and for seasons, and for days, and years:
15 And let them be for lights in the firmament of the heaven to give light upon the earth: and it was so.
16 And God made two great lights; the greater light to rule the day, and the lesser light to rule the night: he made the stars also.
17 And God set them in the firmament of the heaven to give light upon the earth,
18 And to rule over the day and over the night, and to divide the light from the darkness: and God saw that it was good.
19 And the evening and the morning were the fourth day.
20 And God said, Let the waters bring forth abundantly the moving creature that hath life, and fowl that may fly above the earth in the open firmament of heaven.
21 And God created great whales, and every living creature that moveth, which the waters brought forth abundantly, after their kind, and every winged fowl after his kind: and God saw that it was good.
22 And God blessed them, saying, Be fruitful, and multiply, and fill the waters in the seas, and let fowl multiply in the earth.
23 And the evening and the morning were the fifth day.
24 And God said, Let the earth bring forth the living creature after his kind, cattle, and creeping thing, and beast of the earth after his kind: and it was so.
25 And God made the beast of the earth after his kind, and cattle after their kind, and every thing that creepeth upon the earth after his kind: and God saw that it was good.
26 And God said, Let us make man in our image, after our likeness: and let them have dominion over the fish of the sea, and over the fowl of the air, and over the cattle, and over all the earth, and over every creeping thing that creepeth upon the earth.
27 So God created man in his own image, in the image of God created he him; male and female created he them.
28 And God blessed them, and God said unto them, Be fruitful, and multiply, and replenish the earth, and subdue it: and have dominion over the fish of the sea, and over the fowl of the air, and over every living thing that moveth upon the earth.
29 And God said, Behold, I have given you every herb bearing seed, which is upon the face of all the earth, and every tree, in the which is the fruit of a tree yielding seed; to you it shall be for meat.
30 And to every beast of the earth, and to every fowl of the air, and to every thing that creepeth upon the earth, wherein there is life, I have given every green herb for meat: and it was so.
31 And God saw every thing that he had made, and, behold, it was very good. And the evening and the morning were the sixth day.

Humans have less genes than chimps

2011-03-16T23:20:00.000-07:00

This story from Science Digest again discusses how the evolutionists are surprised at what they found out when they scanned the human genome. It seems that we have less genes than chimps so now they have to come up with a new hypothesis of now we changed into human from chimps. Of course God made us this way and that is the answer.

Seeking specific genetic changes that might be responsible for the evolution of uniquely human traits, Howard Hughes Medical Institute investigator David Kingsley and colleagues at Stanford University scanned the human genome for features that set us apart from other mammals. The team found 510 segments that are present in chimps and other animals but missing from the human genome. Only one of the missing segments would actually disrupt a gene; the remaining 509 affect the DNA that surrounds genes, where regulatory sequences lie.
Careful analysis of a handful of these segments demonstrated that loss of regulatory DNA could explain how humans developed some features not found in other animals -- such as big brains -- as well as how they lost features common in other species, such as sensory whiskers and spiny penises. Their findings are published in the March 10, 2011, issue of the journal Nature.
Genes -- segments of DNA that carry the blueprints for proteins -- make up less than two percent of the human genome. Hidden within the remainder of our more than three billion base pairs of DNA are regulatory sequences that control when and where genes are expressed. Direct alterations to a gene can have dramatic effects, sometimes killing an organism or rendering it sterile. "In contrast, if you alter the way [a gene] turns on or off at a particular place in development, that can have a very large effect on a particular structure, but still preserve the other functions of the gene," Kingsley says. "That tends to be the sort of alternation that's favored when a new trait is evolving."
Kingsley's previous work with stickleback fish, a small spiny fish whose recent and rapid adaptation to a wide range of aquatic environments has made it ideal for evolutionary studies, have shown time and again that changes in regulatory DNA can have profound effects on an organism's traits. So when Kingsley and his colleagues searched for regions of the genome common to chimps, macaques, and mice but missing in the human genome, they weren't surprised that the sequence differences they found were almost exclusively outside of genes.
Collaborating with computational biologist Gill Bejerano's lab at Stanford, the team pinpointed 510 genetic sequences that appear in the genomes of chimps and other animals, but are "surprisingly missing" from the human genome, Kingsley says. To narrow the list so that they could focus on the changes most likely to have altered when and where particular genes were expressed, the researchers conducted a computer analysis to identify deletions that were clustered around particular genes. "We saw more changes than you would expect near genes involved in steroid hormone signaling," Kingsley says. A number of deletions also appeared near genes involved in neural development, their analysis revealed.
But technology could only take the team so far. To zero in on specific deletions that might control human traits, the team relied on manpower: neuroscientists, physical anthropologists, developmental geneticists, and more. "We had a team of interested graduate students, postdocs, and developmental biologists poring through this list," Kingsley says. The team searched for sequences near genes known to play key roles in development, especially those known to control traits that differ between humans and other animals. "It was a fun detective hunt that led to lots of interesting discussions," he says.
The team came up with a couple dozen deletions near genes they suspected might be involved in the evolution of particular human traits. But the researchers still didn't know the normal functional roles of the missing sequences. So Kingsley and his colleagues isolated those genetic sequences from organisms that still had them (chimps or mice), attached the sequences to a reporter gene that produces a simple blue color reaction in living cells, and injected the resulting sequences into fertilized mouse eggs. By monitoring the blue color reaction in developing mice, they could see exactly where and when the sequence was turning on gene expression during embryonic or postnatal development. This gave them a way to link "the biology of the gene, the molecular change that had happened in humans, and the specific anatomical place where it really was expressed during normal development," Kingsley explains.
These experiments highlighted two segments of DNA that humans lack, but that appear to play a particularly important role in development of mice and other non-human mammals. The first is a segment of DNA that, in most animals, occurs near the gene that codes for the androgen receptor, which is associated with a variety of male-specific traits. "Males have beards, females don't," Kingsley says. "That's an example of an androgen receptor-dependent process." When the researchers inserted this sequence into mouse eggs, "what we got were blue sensory whiskers and blue genitalia," Kingsley says, indicating that when present, the sequence causes the androgen receptor to be produced in those regions.
Tracing the expression of the protein through development, Kingsley and his colleagues concluded that the sequence contributes to the development of sensory whiskers found on the faces of many mammals, and prickly surface spines found on the penises of mice and many non-human primates. Previous studies show that complete inactivation of the androgen receptor gene lead to defects in whiskers and failure to form penile spines. Although humans still retain the androgen receptor gene, the loss of regulatory information for expression in whiskers and spines could help explain two human-specific anatomical traits: absence of sensory whiskers and lack of spines on human penises. Loss of penile spines is one of several traits thought to be related to evolution of pair-bonding and monogamy in the human lineage.
The second segment of regulatory DNA they tested appears, in non-humans, near a gene called GADD45g. GADD45g normally reins in cell growth. In fact, Kingsley said, "if the gene is missing entirely, unchecked cell growth can cause pituitary tumors." When they injected the sequence into mouse eggs, they found the tell-tale blue color in a key growth layer of the developing brain -- indicating that in most animals, the regulatory sequence that has disappeared in humans restricts brain growth.
The study describes some of the changes that have helped make humans human, but there are likely to be many more, Kingsley says. "By simply changing a single gene like GADD45g you're not going to be able to explain all of human brain evolution."
Still, he adds, the study shows that "it's now possible to begin identifying some of the particular molecular changes that contribute to the evolution of human traits." Human-specific traits include not only anatomical and physiological differences, but also differences in our susceptibility to many diseases, such as arthritis, cancer, malaria, HIV, Alzheimer's, and Parkinson's. "We think that the same sorts of lists and approaches will eventually help illuminate human disease susceptibilities as well," he says. "It's a great time to be studying not only where we came from, but also how our genetic history shapes many aspects of current human biology."

Story Source:
The above story is reprinted (with editorial adaptations by ScienceDaily staff) from materials provided by Howard Hughes Medical Institute, via EurekAlert!, a service of AAAS.

--------------------------------------------------------------------------------

Journal Reference:
Cory Y. McLean, Philip L. Reno, Alex A. Pollen, Abraham I. Bassan, Terence D. Capellini, Catherine Guenther, Vahan B. Indjeian, Xinhong Lim, Douglas B. Menke, Bruce T. Schaar, et al. Human-specific loss of regulatory DNA and the evolution of human-specific traits. Nature, 471, 216-219 (9 March 2011) DOI: 10.1038/nature09774

Fossil Bones look human but aren't

2011-02-22T12:09:00.000-08:00

This article by Science Digest is a great support for those who protest against ape to man evolution.

Web address:
http://www.sciencedaily.com/releases/2011/02/
110216132034.htm
Fossils May Look Like Human Bones: Biological Anthropologists Question Claims for Human Ancestry
An orangutan. Ramapithecus, a species of fossil ape from south Asia, was mistakenly assumed to be an early human ancestor in the 1960s and 1970s, but later found to be a close relative of the orangutan. Researchers conclude that instead of being our ancestors many fossils more likely belong to extinct distant cousins. (Credit: iStockphoto/Derek Dammann)ScienceDaily (Feb. 16, 2011) — "Too simple" and "not so fast" suggest biological anthropologists from the George Washington University and New York University about the origins of human ancestry. In the upcoming issue of the journal Nature, the anthropologists question the claims that several prominent fossil discoveries made in the last decade are our human ancestors. Instead, the authors offer a more nuanced explanation of the fossils' place in the Tree of Life. They conclude that instead of being our ancestors the fossils more likely belong to extinct distant cousins.
"Don't get me wrong, these are all important finds," said co-author Bernard Wood, University Professor of Human Origins and professor of Human Evolution Anatomy at GW and director of its Center for the Advanced Study of Hominid Paleobiology. "But to simply assume that anything found in that time range has to be a human ancestor is naïve."
The paper, "The evolutionary context of the first hominins," reconsiders the evolutionary relationships of fossils named Orrorin, Sahelanthropus and Ardipithecus, dating from four to seven million years ago, which have been claimed to be the earliest human ancestors. Ardipithecus, commonly known as "Ardi," was discovered in Ethiopia and was found to be radically different from what many researchers had expected for an early human ancestor. Nonetheless, the scientists who made the discovery were adamant it is a human ancestor.
"We are not saying that these fossils are definitively not early human ancestors," said co-author Terry Harrison, a professor in NYU's Department of Anthropology and director of its Center for the Study of Human Origins. "But their status has been presumed rather than adequately demonstrated, and there are a number of alternative interpretations that are possible. We believe that it is just as likely or more likely that they are fossil apes situated close to the ancestry of the living great ape and humans."
The authors are skeptical about the interpretation of the discoveries and advocate a more nuanced approach to classifying the fossils. Wood and Harrison argue that it is naïve to assume that all fossils are the ancestors of creatures alive today and also note that shared morphology or homoplasy -- the same characteristics seen in species of different ancestry -- was not taken into account by the scientists who found and described the fossils. For example, the authors claim that for Ardipithecus to be a human ancestor, one must assume that homoplasy does not exist in our lineage, but is common in the lineages closest to ours. The authors suggest there are a number of potential interpretations of these fossils and that being a human ancestor is by no means the simplest, or most parsimonious explanation.
The scientific community has long concluded that the human lineage diverged from that of the chimpanzee six to eight million years ago. It is easy to differentiate between the fossils of a modern-day chimpanzee and a modern human. However, it is more difficult to differentiate between the two species when examining fossils that are closer to their common ancestor, as is the case with Orrorin, Sahelanthropus, and Ardipithecus.
In their paper, Wood and Harrison caution that history has shown how uncritical reliance on a few similarities between fossil apes and humans can lead to incorrect assumptions about evolutionary relationships. They point to the case of Ramapithecus, a species of fossil ape from south Asia, which was mistakenly assumed to be an early human ancestor in the 1960s and 1970s, but later found to be a close relative of the orangutan.
Similarly, Oreopithecus bambolii, a fossil ape from Italy shares many similarities with early human ancestors, including features of the skeleton that suggest that it may have been well adapted for walking on two legs. However, the authors observe, enough is known of its anatomy to show that it is a fossil ape that is only distantly related to humans, and that it acquired many "human-like" features in parallel.
Wood and Harrison point to the small canines in Ardipithecus and Sahelanthropus as possibly the most convincing evidence to support their status as early human ancestors. However, canine reduction was not unique to the human lineage for it occurred independently in several lineages of fossil apes (e.g., Oreopithecus, Ouranopithecus and Gigantopithecus) presumably as a result of similar shifts in dietary behavior.
Email or share this story:| More
--------------------------------------------------------------------------------

Story Source:
The above story is reprinted (with editorial adaptations by ScienceDaily staff) from materials provided by New York University.

--------------------------------------------------------------------------------

Journal Reference:
Bernard Wood, Terry Harrison. The evolutionary context of the first hominins. Nature, 2011; 470 (7334): 347 DOI: 10.1038/nature09709
Need to cite this story in your essay, paper, or report? Use one of the following formats:
APA

MLA
New York University (2011, February 16). Fossils may look like human bones: Biological anthropologists question claims for human ancestry. ScienceDaily. Retrieved February 21, 2011, from http://www.sciencedaily.com; /releases/2011/02/110216132034.htm
Note: If no author is given, the source is cited instead.
Disclaimer: Views expressed in this article do not necessarily reflect those of ScienceDaily or its staff.

Science Daily article about Neandertals

2011-01-08T10:37:00.000-08:00

This article about Neandertals indicates that they were part of the "worlds" that existed before Genesis 1.

Neandertals’ Extinction Not Caused by Deficient Diets, Tooth Analysis Shows
ScienceDaily (Jan. 1, 2011) — Researchers from George Washington University and the Smithsonian Institution have discovered evidence to debunk the theory that Neandertals' disappearance was caused in part by a deficient diet -- one that lacked variety and was overly reliant on meat. After discovering starch granules from plant food trapped in the dental calculus on 40-thousand-year-old Neandertal teeth, the scientists believe that Neandertals ate a wide variety of plants and included cooked grains as part of a more sophisticated, diverse diet similar to early modern humans.

"Neandertals are often portrayed as very backwards or primitive," said Amanda Henry, lead researcher and a post-doctoral researcher at GW. "Now we are beginning to understand that they had some quite advanced technologies and behaviors."

Dr. Henry made this discovery together with Alison Brooks, professor of anthropology and international affairs at GW, and Dolores Piperno, a GW research professor and senior scientist and curator of archaeobotany and South American archaeology at the Smithsonian National Museum of Natural History, Washington D.C., and Smithsonian Tropical Research Institute, Panama.

The discovery of starch granules in the calculus on Neandertal teeth provides direct evidence that they made sophisticated, thoughtful food choices and ate more nutrient-rich plants, for example date palms, legumes and grains such as barley. Until now, anthropologists have hypothesized that Neandertals were outlived by early modern humans due in part to the former's primitive, deficient diet, with some scientists arguing Neandertals' diets were specialized for meat-eating. As such, during major climate swings Neandertals could be outcompeted by early humans who incorporated diverse plant foods available in the local environment into their diets.

Drs. Henry, Brooks and Piperno's discovery suggests otherwise. The researchers discovered starch granules in dental calculus, which forms when plaque buildup hardens, on the fossilized teeth of Neandertal skeletons excavated from Shanidar Cave in Iraq and Spy Cave in Belgium. Starch granules are abundant in most human plant foods, but were not known to survive on fossil teeth this old until this study. The researchers' findings indicate that Neandertals' diets were more similar to those of early humans than originally thought. The researchers also determined from alterations they observed in the starch granules that Neandertals prepared and cooked starch-rich foods to make them taste better and easier to digest.

"Neandertals and early humans did not visit the dentist," said Dr. Brooks. "Therefore, the calculus or tartar remained on their teeth, preserving tiny clues to the previously unknown plant portion of their diets."

Dr. Henry is currently a post-doctoral researcher in the Columbian College of Arts and Sciences Hominid Paleobiology program at the George Washington University, where she also received her Ph.D. in Jan. 2010. Her research focuses on the uses of plant foods by human ancestors. In Jan. 2011, Dr. Henry will begin leading an independent research group focusing on the evolution of human diet at the Max Planck Institute for Evolutionary Anthropology in Leipzig, Germany. Dr Brooks' research focuses on the evolution of modern human behavior. Dr. Piperno is a pioneer in the detection and study of plant microfossils and the evolution of human diets.

"This significant finding provides new insight on the plight of the Neandertals," said Peg Barratt, dean of GW's Columbian College of Arts and Sciences. "It's also an excellent example of our dynamic partnership with the Smithsonian to further advance learning and discovery."

The research was supported by a National Science Foundation IGERT award, a Wenner Gren Foundation doctoral dissertation award, a Smithsonian Institution pre-doctoral fellowship, a National Science Foundation HOMINID award to the Smithsonian Institution and a selective excellence award from the George Washington University
--------------------------------------------------------------------------------

Story Source:

The above story is reprinted (with editorial adaptations by ScienceDaily staff) from materials provided by George Washington University.

--------------------------------------------------------------------------------

Journal Reference:

A. G. Henry, A. S. Brooks, D. R. Piperno. Microfossils in calculus demonstrate consumption of plants and cooked foods in Neanderthal diets (Shanidar III, Iraq; Spy I and II, Belgium). Proceedings of the National Academy of Sciences, 2010; DOI: 10.1073/pnas.1016868108

Some thoughts on radiometric dating

2011-01-08T10:27:00.000-08:00

( I am posting an article from Answersingenesis who uses all data to push for a 6,000 year old earth. The GAP theory believes that the earth is old and had been re-vitalized, but it makes sense that the part of top layer of the earth is young and under 6,000 years old. I do not see how a tree could be more than 6,000 years old as all trees were made again during creation week.)
From Evolutiion Exposed
Most scientists and many Christians believe that the radiometric dating methods prove that the earth is 4.5 billion years old. The textbooks speak of the radiometric dating techniques, and the dates themselves, as factual information. Far from being data, these dates are actually interpretations of the data. As discussed before, the assumptions influence the interpretation of the data. There are three main assumptions that must be made to accept radiometric dating methods. These must be accepted on faith in uniformitarian and naturalistic frameworks.

Recent research by a team of creation scientists known as the RATE (Radioisotopes and the Age of The Earth) group has demonstrated the unreliability of radiometric dating techniques. Even the use of isochron dating, which is supposed to eliminate some initial condition assumptions, produces dates that are not reliable. Despite the fact that there are many scientific problems with radiometric dating, there is a more significant problem. The Bible gives a much different picture and explains that relying on man’s reasoning is foolishness. A fear of God and reverence for His Word is the beginning of wisdom. Starting with the Bible and developing a model for dating events in earth history will lead us to the truth. The Bible gives us a much more reliable history of the earth as it was recorded by God.

What We Really Know about Dating Methods
When someone mentions scientific dating methods, the first thing to come to mind for most people is carbon dating. However, there are many methods that can be used to determine the age of the earth or other objects. The textbooks focus on relative dating, based on the layering of the rocks, and radiometric dating.

Relative ages are assigned to rocks based on the idea that rock layers lower in the strata were deposited before rock layers that are higher. Creationists do not necessarily disagree with this concept, but it can only be applied to layers that are found in one location and/or can be determined to have been deposited in a continuous layer over a very wide area. There is also a difference in the timescale used to explain the layers. Determining the relative age of a rock layer is based on the assumption that you know the ages of the rocks surrounding it. Uniformitarian geologists use so-called absolute dating methods to determine the ages of the surrounding rocks.

Certain types of rocks, especially those that form from magma (igneous), contain radioactive isotopes of different elements. It is possible to measure the ratio of the different radioactive parent isotopes and their daughter isotopes in a rock, but the ratios are not dates or ages. The dates must be inferred based on assumptions about the ratios. Some of the common isotope pairs used are K-Ar, Rb-Sr, Pb-Pb, and U-Pb.

Radiometric Dating
Using ratios of isotopes produced in radioactive decay to calculate an age of the specimen based on assumed rates of decay and other assumptions.
Carbon-14 dating is another common technique, but it can only be used on carbon-containing things that were once alive. The method of calculating radiometric dates is like using an hourglass. You can use the hourglass to tell time if you know several things: the amount of sand in the top of the hourglass when it started flowing, the rate that the sand flows through the hole in the middle, and that the quantity of sand in each chamber has not been tampered with. If any of these three conditions is not accurately known, the hourglass will give an inaccurate measure of time.

Using an hourglass to tell time is much like using radiometric dating to tell the age of rocks. There are key assumptions that we must accept in order for the method to be reliable.
Radiometric dating is based on the fact that radioactive isotopes decay to form isotopes of different elements. The starting isotope is called the parent and the end-product is called the daughter. The time it takes for one half of the parent atoms to decay to the daughter atoms is called the half-life. If certain things are known, it is possible to calculate the amount of time since the parent isotope began to decay. For example, if you began with 1 gram of carbon-14, after 5,730 years you would be left with 0.50 g and only 0.25 g after 11,460 years. The reason this age may not be a true age—even though it is commonly called an absolute age—is that it is based on several crucial assumptions. Most radiometric dating techniques must make three assumptions:

The rate of radioactive decay is known and has been constant since the rock formed.
There has been no loss or gain of the parent or daughter isotopes from the rock.
The amounts of parent and daughter isotopes present when the rock formed are known.
The major problem with the first assumption is that there is no way to prove that the decay rate was not different at some point in the past. The claimed “fact” that decay rates have always been constant is actually an inference based on a uniformitarian assumption. It is true that radioisotope decay rates are stable today and are not largely affected by external conditions like change in temperature and pressure, but that does not mean that the rate has always been constant.

Recent research by a creation science group known as RATE (Radioisotopes and the Age of The Earth) has produced evidence of accelerated rates of decay at some point (or points) in the past. Creation scientists suggest that there are two possible times that God supernaturally intervened on a global scale—during Creation Week and the Flood. It is not unreasonable to assume that God used the energy of accelerated radioactive decay to initiate and drive the major geologic changes in the earth that accompanied the Flood.

Evidence for the period of accelerated decay is found in zircon crystals. Zircon crystals in granite contain radioactive uranium-238, which decays into lead over time. As the uranium decays, helium is produced in the crystals. Helium escapes from the crystals at a known, measurable rate. If those rocks were over a billion years old, as evolutionists claim, the helium should have leaked out of the rock. The presence of lots of helium in the crystals is evidence in support of a young earth.

Fossils and rocks do not come with dates stamped on them. The dates must be interpreted based on the evidence. Biblical geologists start with the assumptions laid out in the Bible and conclude that the rocks must be less than 6,000 years old. Evolutionists reject the authority of the Bible and conclude that the rocks must be millions or billions of years old.
Other important findings of the RATE project include detecting carbon-14 in coal and diamonds. If these substances were really millions or billions of years old respectively, there should be no carbon-14 left in them. Carbon-14 has a half-life of 5,730 years. With the most accurate mass spectrometers, the oldest calculated age of items containing carbon-14 is about 80,000 years. Diamonds are assumed to be many billions of years old and should contain no detectable carbon-14 as it would have all decayed to nitrogen-14 long ago. The same is true of coal which was supposedly deposited hundreds of millions of years ago, according to the evolutionary model. The presence of carbon-14 in these materials clearly supports the idea of a young earth as described by the Bible.

The assumption that there has been no loss or gain of the isotopes in the rock (assumption 2) does not take into account the impact of weathering by surface and ground waters and the diffusion of gases. It is impossible to know to what degree the parent and daughter products have been added to or removed from the rocks over the alleged millions or billions of years.

The final assumption (assumption 3) does not take into account the fact that isotopes can be inherited from the source areas of magmas and/or from surrounding rocks as the magmas pass through the mantle and crust of the earth. Uniformitarian geologists do make efforts to eliminate errors, but the fact that rocks of known recent age give dates of millions, and even billions, of years supports the claim that radiometric dating cannot provide accurate “absolute” dates. Also, samples taken a few feet apart can give ages that differ by many hundreds of millions of years.

Many people do not realize that fossils themselves are usually not directly dated. Instead, layers that contain datable igneous rocks above or below a fossil-bearing layer are used to estimate the age of the fossil. The age of the fossil can be estimated within the range of the layers above and below it. In some cases, the ages are correlated to other rock layers of supposedly known age or by using index fossils. These methods assume that the distribution of index fossils and the correlation of strata are well understood on a global scale.

Another finding of the RATE team is very intriguing. The team took samples of diabase, an igneous rock, and tested them using various radiometric dating techniques. If the dating methods are all objective and reliable, then they should give similar dates. The rocks were tested as whole-rock samples using K-Ar dating and also separated into individual minerals. The whole-rock and separated mineral samples allow a method known as isochron dating to be done. This method is supposed to eliminate the assumption that the initial concentration of the daughter element is zero.

The facts from the rock layers do not speak for themselves—they must be interpreted. The assumptions used to interpret the data influence the conclusion. Starting with the Bible produces different conclusions than starting with evolutionary reasoning.
Despite removing this assumption, the RATE team has shown that this method is not reliable. Dating the Cardenas Basalt, a layer near the bottom of Grand Canyon, and a volcanic layer from near the top of Grand Canyon produced an amazing result. Based on the law of superposition, the lower layers in the canyon should be older than the upper layers (unless there was an intrusion or other event that changed the order). Using isochron dating from a respected lab, the lower rocks were dated at 1.07 billion years and the upper, and presumably younger rocks, were dated at 1.34 billion years. There is an obvious discordance (disagreement) in the data. So the question becomes, “Can we trust the dates given in the textbooks if the techniques are not objective?” (More information on the RATE research can be found in article 4:3.)

Because these dates are based on methods with multiple assumptions, and are contrary to the Bible, we must reject that they are accurate. Despite the fact that a majority of scientists and even many theologians accept the dates, God’s Word must be our ultimate authority.

There are many other methods that can be used to establish ages for parts of the earth and the solar system. These methods will be discussed in the following chapter. Regardless of what method we use, we must start with assumptions and interpret the facts accordingly. Understanding what those assumptions are is important. If we are not aware of the assumptions that are being used, we can easily be deceived. We should always start with the Bible, the ultimate source of truth.

When we try to use man’s ideas and assumptions to understand nature, we are forgetting that Proverbs 2:1–6 tells us:

My son, if you receive my words, and treasure my commands within you,
So that you incline your ear to wisdom, and apply your heart to understanding;
Yes, if you cry out for discernment, and lift up your voice for understanding,
If you seek her as silver, and search for her as for hidden treasures;
Then you will understand the fear of the Lord, and find the knowledge of God.
Reference Article Summaries
4:1 Does radiometric dating prove the earth is old?
Riddle, www.answersingenesis.org/articles/nab/does-radiometric-dating-prove
Proponents of evolution suggest that radiometric dating has proven that the earth is between 4.5 and 4.6 billion years old. But what is this age based on? A straightforward reading of the Bible shows that the earth was created in six days about 6,000 years ago. Radiometric dating uses ratios of isotopes in rocks to infer the age of the rock.

Scientists use a mix of observational data and assumptions about the past to determine the radiometric age of a rock. Comparing the amount of a parent isotope to the amount of its daughter isotope and knowing the rate of change from parent into daughter (known as the half-life), the age of the rock can be determined. However, there are several assumptions that must be made in this process.

The three critical assumptions are:

The initial conditions of the rock sample are accurately known.
The amount of parent or daughter elements in a sample has not been altered by processes other than radioactive decay.
The decay rate (or half–life) of the parent isotope has remained constant since the rock was formed.
An hourglass can be used as an analogy to explain the assumptions. An hourglass can be used to tell time only if we know how much sand was in each chamber at the beginning, that there was no sand added or removed from either chamber, and that the sand falls at a constant rate. If any of these factors is not known, the time given may not be accurate. The same goes for the dating of rocks using radioisotopes. Assumption 1 was proven false when scientists from the RATE group had rocks of known age dated. These rocks were dated at up to 3.5 million years old when none of them were older than 70 years. How can we trust this method to tell us the age of rocks when the data do not match with observations?

Isochron dating is supposed to remove the assumption of initial conditions, but some different assumptions are necessary. If radiometric dating techniques are objective and accurate, then comparing the single–sample dates to the isochron dates should give similar results. In the RATE report there were dates that differed by up to a billion years. One volcanic rock layer from the top of Grand Canyon was dated 270 million years older than the oldest rocks below it near the bottom of the canyon.

Other case studies by the RATE group show dates that vary greatly depending on the sample and dating technique used. The most reasonable explanation seems to be that the rates of decay have been different at some point in the past. This is supported by the presence of large amounts of helium in some minerals. If there had been more than a billion years since the rocks had formed, the helium should have leaked out of the rocks by now. The presence of helium seems to support the recent accelerated decay of the isotopes, leaving a large amount of helium trapped in the rocks.

The Bible presents a very different picture of the age of the earth when compared to radiometric dating using evolutionary assumptions. It is better to use the infallible Word of God for our scientific assumptions than to compromise it with man’s ideas.

4:2 Doesn’t carbon-14 dating disprove the Bible?
Riddle, www.answersingenesis.org/articles/nab/does-c14-disprove-the-bible
Radiometric dating is a technique that uses the change of one isotope, the parent, to another, the daughter, to determine the amount of time since the decay began. Carbon-14 is supposed to allow dating of objects up to 60,000 years. If these dates were true, they would seem to discredit the biblical account of a young earth of about 6,000 years.

Since the Bible is the inspired Word of God, we should examine the validity of the standard interpretation of carbon-14 dating by asking several questions:

Is the explanation of the data derived from empirical, observational science, or an interpretation of past events (historical science)?
Are there any assumptions involved in the dating method?
Are the dates provided by carbon-14 dating consistent with what we observe?
Do all scientists accept the carbon-14 dating method as reliable and accurate?
Carbon-14 dating is used to date things that were once living. The unstable carbon-14 decays to stable nitrogen-14 as one of its protons is converted to a neutron through beta decay. Carbon-14 is constantly supplied as high energy neutrons collide with nitrogen-14 in the upper atmosphere. This carbon-14 combines with oxygen to form carbon dioxide and is taken in by plants and then animals. Each living thing should have roughly the same ratio of radioactive carbon-14 to normal carbon-12.

When an organism dies, it no longer takes in carbon-14, and the decay process begins. Assuming that the rate of decay and the starting amount of carbon-14 is known, this decay process can be used as a clock. However, the ratio of carbon isotopes is not constant and can be affected by the earth’s magnetic field strength and the amount of plant and animal matter in the biosphere. The plants and animals buried in the recent Flood could account for a large change in the ratios and demonstrate the false assumption of carbon equilibrium.

The RATE group has also documented carbon-14 in coal and diamonds that are supposed to be millions to billions of years old. If these items were truly more than 100,000 years old, there should be no detectable carbon-14 present in them. These findings point to the age of the earth being much younger than evolutionary scientists would suggest.

4:3 Radioisotopes and the age of the earth
Snelling, www.answersingenesis.org/articles/aid/v2/n1/radioisotopes-earth
A long-term research project involving several creation scientists has produced intriguing new evidence in support of an earth that is thousands of years old rather than many billions. Some of the findings are summarized below.

The presence of fission tracks and radiohalos in crystals demonstrates that hundreds of millions of years worth of radioactive decay has occurred in a very short period. Because the Bible indicates the earth is young (about 6,000 years old), this large quantity of nuclear decay must have occurred at much faster rates than those measured today.

Using various radiometric dating methods to measure the ages of rock samples consistently produced ages that varied greatly. This may be explained by the different parent atoms having decayed at different rates in the past—an explanation not allowed by evolutionists. These changes in decay rates could be accounted for by very small changes in the binding forces within the nuclei of the parent atoms.

Research has been done to demonstrate that many of the assumptions used in radiometric dating are false. Starting from biblical assumptions regarding the Flood and Creation can provide a new framework for interpreting current scientific data.

4:4 Tree rings and biblical chronology
Lorey, www.icr.org/article/381Bristlecone pines are the oldest living things on the earth. Native to the mountains of California and Nevada, the oldest tree has been dated at 4,600 years old. By correlating the rings with dead wood found near the trees and beams from local buildings, a chronology of 11,300 rings has been suggested. However, this does not necessarily correlate to years because multiple rings can grow in one year.

The 4,600 year age of the oldest tree, named Methuselah, corresponds to the date of the Flood given by Ussher and others. If Methuselah began growing shortly after the Flood, then it stands as a record that confirms the Bible.

4:5 Are there half a million years in the sediments of Lake Van?
Oard, www.answersingenesis.org/articles/aid/v2/n1/sediments-lake-van
Lake Van is a salt lake in Turkey that uniformitarian scientists believe holds a record of the last 800,000 years of the earth’s climate. The layers of sediment are up to 400 meters thick and were supposedly laid down one layer at a time each year. Evolutionists assume the layers, called varves, roughly correspond to years based on assumptions about present processes.

Varves are also used to date other lakes around the world to the time of the last ice age—supposedly 10,000 years ago. Many other alleged varve deposits challenge the biblical timescale and must be reinterpreted within the creationist framework. The repeating layers should be referred to as rhythmites and simply represent successive deposits over time. These different layers can be deposited as particles of different size and density settle out of flowing water. Studies at Lake Walensee, Switzerland, showed over 300 layers forming in 160 years. Different areas had different patterns and were not able to be correlated directly.

Other studies have shown multiple layers forming as the result of light rainfall, increasing river flow, and increased snowmelt. Underwater turbidity currents are often interpreted as varves, but they form many layers rapidly. It is common, therefore, for multiple layers to form in a single year.

All of these layers can be explained within the Flood model as catastrophic melting and drainage events deposited many layers over a short period of time during localized residual catastrophism in the immediate aftermath of the Flood. Uniformitarian geologists assume the slow rate of deposition as observed today for the past. However, in many cases they really have not observed the present sedimentation rate, and in some cases where they have used sediment traps, not all the deposition has been recorded. Creationists, on the other hand, can postulate much higher rates in the past due to the Flood, localized residual post-Flood catastrophism, and/or a rapid post-Flood Ice Age—the rate tapering off to the present slow rate.

Questions to Consider
Do radiometric dating techniques always show that rocks lower in the geologic layers are older than rocks that are higher?
If radiometric dating on rocks known to be only a few years old yields dates of millions of years, why should we trust that the techniques can be used to accurately date rocks of unknown ages?
In radiometric dating techniques, how do we know how much parent material the sample started with? How do we know none of the parent or daughter isotope was added or removed? How do we know the decay rate is constant?
When items are carbon-14 dated, how do we know how much carbon-14 was initially present in the sample? Could the ratio of carbon-14 to carbon-12 have been different at different times in earth’s history? How can scientists accurately adjust their calculations if the isotope ratios were never observed and recorded?
What assumptions are involved in radiometric dating?
Tools for Digging Deeper
Evolution: The Fossils Still Say No! by Duane Gish

The Geology Book by John Morris

The New Answers Book by Ken Ham et al.

The New Answers Book 2 by Ken Ham et al.

Radioisotopes and the Age of the Earth Volume 1 (Technical) by ICR

Radioisotopes and the Age of the Earth Volume 2 (Technical) by ICR

Thousands . . . Not Billions by Don DeYoung

www.answersingenesis.org/go/dating

Tools not a sign of evolution to man (From BBC Earth News October 2010)

2010-10-30T14:18:00.000-07:00

Young New Caledonian crows learn to use tools by going to "tool-school", where they can observe their parents at work.

These crows are renowned for their extraordinary intelligence and ability to fashion tools to solve problems.

Now a new study has revealed more about how they do it: wild New Caledonian crows live in unusually small family groups, scientists say.

That allows parent birds to take juveniles to tool-using sites, and let young birds play with "grown up" tools.

Talented toolsmiths

Birds belonging to the crow family such as magpies, crows and ravens, known as corvids, are renowned for their innovative behaviour, relatively large brains and general intelligence.

Even among this group, New Caledonian crows (Corvus moneduloides) stand out: they make the most complex tools of any animal yet studied apart from humans.

TALENTED CROWS

Brown-necked ravens team up to hunt lizards, revealing an unexpected level of intelligence, scientist discovered last year

For example, they will evolve and improve the shape of their tools over time, and will fashion left handed or right handed tools.

These tools are usually made to help catch insects and other invertebrates.

Earlier this year, scientists at the Department of Psychology at the University of Auckland, New Zealand discovered that the birds were able to use three tools in succession to reach some food.

However, despite these extraordinary abilities, little is known about how wild New Caledonian crows live, and how they acquire these skills.

To investigate, Jenny Holzhaider and colleagues at the University of Auckland studied the social organisation of New Caledonian crows in their natural habitat on the island of Maré, New Caledonia, which lies in the South Pacific Ocean to the east of Australia and north of New Zealand.

Observations revealed that unlike many other crow species, New Caledonian crows are not highly social.

Instead, they tend to live in small, tight-knit family units comprising two parents and offspring from up to two consecutive breeding years.

Clever crows can use many tools to solve a task
The parents stay together all year and seem to especially tolerate the presence of the juveniles.

"Their social system is based on high quality relationships with a small number of crows, especially immediate family," co-researcher Gavin Hunt told the BBC.

The discovery rules out the idea that New Caledonian crows live in complex social groups, and learn their skills from their peers.

Instead it suggests that the crows develop their tool-using abilities by "keeping it in the family", say the researchers, who publish their findings in the journal Animal Behaviour.

SOURCES

Visit Animal Behaviour to read more about the social structure of New Caledonian crows
What is more, the parent crows appear to go to considerable lengths to ensure their offspring can learn how to fashion and use tools.

"[Juveniles] closely follow and watch their parents' behaviour, are taken to tool using sites, and are 'allowed' to use the tools of their parents," says Dr Hunt.

Structuring their education in this way may also help explain how the crows improve their tools over time, as young crows may learn from their parent's mistakes.

More proof for Pre-Adamic civilization

2010-10-30T14:09:00.001-07:00

Rachel Kaufman

for National Geographic News

Published October 25, 2010

A fossil human jawbone discovered in southern China is upsetting conventional notions of when our ancestors migrated out of Africa.

The mandible, unearthed by paleontologists in China's Zhiren Cave in 2007, sports a distinctly modern feature: a prominent chin. But the bone is undeniably 60,000 years older than the next oldest Homo sapiens remains in China, scientists say.

In fact, at about a hundred thousand years old, the Chinese fossil is "the oldest modern human outside of Africa," said study co-author Erik Trinkaus, an anthropologist at Washington University in St. Louis.

(Also see "Oldest Skeleton of Human Ancestor Found.")

Popular theory states that Homo sapiens migrated out of Africa about 60,000 years ago, at which point modern humans quickly replaced early human species such as Homo erectus and Homo neanderthalensis across the world.

Finding such an ancient example of a modern human in China would drastically alter the time line of human migration. The find may also mean that modern humans in China were mingling—and possibly even interbreeding—with other human species for 50,000 or 60,000 years.

(Related: "Neanderthals, Humans Interbred—First Solid DNA Evidence.")

What's more, the find seems to suggest that anatomically modern humans had arrived in China long before the species began acting human.

For example, symbolic thought is a distinctly human trait that involves using things such as beads and drawings to represent objects, people, and events. The first strong evidence for this trait doesn't appear in the archaeological record in China until 30,000 years ago, Trinkaus said.

(Related: "Oldest Jewelry Found in Morocco Cave.")

Hoping for DNA Evidence

So far, genetic evidence largely supports the traditional timing of the "out of Africa" theory. But the newly described China jawbone presents a strong challenge, said anthropologist Christopher Bae of the University of Hawaii, who was not associated with the find.

"They actually have solid dates and evidence of, basically, a modern human," he said.

Still, the jaw and three molars were the only human remains retrieved from the Chinese cave, and the jaw is "within the range" of Neanderthal chins as well as those of modern humans, added paleoanthropologist John Hawks of the University of Wisconsin, Madison.

(Related: "Oldest Human Footprints With Modern Anatomy Found.")

"If this holds up, we have to reevaluate" the human migration time line, he said.

"Basically, I think they're right, [but] I want to see more evidence," Hawks added. "I really, really hope that there can be some sort of genetic extraction from this [fossil]."

The oldest human jawbone from China is described in this week's issue of the Proceedings of the National Academy of Sciences.

Rain before Flood

2010-10-30T14:03:00.000-07:00

There Was No Rain Before the Flood
Arguments Christians Should Not Use
by Dr. Tommy Mitchell, AiG–U.S.
October 19, 2010
Layman

Some Christians claim that there was no rain before the Flood. Many of them make this statement quite dogmatically as if it were obvious from a reading of the biblical text. However, a close examination of Scripture does not bear this out.
A Biblical Analysis
Proponents of the “no-rain” view refer to Genesis 2 to support their position. Genesis 2:5–6 states that “the LORD God had not caused it to rain upon the earth, and there was not a man to till the ground. But there went up a mist from the earth, and watered the whole face of the ground” (empashsis added).
From this passage, all that can really be said is that no rain had fallen up to that time—that is, prior to the creation of man. Remember, Genesis 2 is primarily a detailed recap of Day Six of Creation Week. The passage describes the environment before Adam was created. This mist may have been one of the primary methods that God used to hydrate the dry land He created on Day Three. Furthermore, while this mist was likely the watering source for that vegetation throughout the remainder of Creation Week, the text does not require it to be the only water source after Adam’s creation.
Some argue that this mist eliminated the need for rain until the time of the Flood. However, presence of the mist prior to Adam’s creation does not preclude the existence of or the need for rain after he was created.
Genesis 2:5–6 reveals that before the Sixth Day of Creation Week, God had watered the plants He made with a mist, but had not yet caused rain or created a man to till the ground. To demand that rain didn’t happen until after the Flood from this passage has no more logical support than to claim, from the passage, that no one farmed until after the Flood.
Water Cycle
Another often-overlooked aspect of this argument is that rain is an integral component of the water cycle. The term water cycle refers to the physical processes of water evaporation, cloud formation, and precipitation (rain, snow, etc.) that continually recycle the world’s water supply.
The water cycle, being powered as it is by the sun’s energy, is intimately tied to many other aspects of the earth’s climate. While we cannot be dogmatic about the details of the pre-Flood environment, we can be certain that the sun and seas were present (Genesis 1:10, 16). Therefore, there is no reason to insist that this normal environmental process was not in operation before the Flood.
Things Not Seen?
Another passage often cited is Hebrews 11:7 in which we learn that “by faith Noah, being warned of God of things not seen as yet, moved with fear, prepared an ark.” Some assert that “things not seen” means rain, implying that no one had ever seen rain before Noah’s Flood. However, the passage more likely is referring to the impending catastrophic global Flood—certainly something not yet seen, not imaginable to anyone, and far more needful of a warning than a nice spring shower!
It is fascinating to speculate about the pre-Flood environment. We would expect it to differ from today’s environment. Both the cataclysmic forces with which God produced the Flood and the great changes in the surface of the earth in the aftermath of the Flood—breaking open the fountains of the deep, for instance, with volcanic activity, disturbance of tectonic plates with reconfiguration of land masses, and deepening of the oceans to accommodate the floodwaters—would result in permanent changes in the world’s topography and climate. However, we should use caution in making absolute statements about that environment, as there are many things about the pre-Flood world that we cannot know with certainty.
Rainbow
Well, then, how about the rainbow? Didn’t God specially create the never-before-seen rainbow as a sign of His promise? Not necessarily. In Genesis 9:13, God said, “I do set my bow in the cloud,” and the fact that God does not imply that He had never set a rainbow in the clouds before but only that, from now own, the rainbow—appearing as it so often does as rain is ending—would henceforth have a special significance as a token (reminder 1) of God’s promise to never again send a worldwide Flood.
Conclusion
While we cannot prove that there was rain before the Flood, to insist that there was not (and even to deride those who think otherwise) stretches Scripture beyond what it actually says.
There are some arguments that Christians should avoid because of their absurdity and some we should avoid being dogmatic about because they are not truly supportable from Scripture. The “no-rain” argument is in the latter category, and as such, it is an argument Christians should not use.

Footnotes
Assigning special significance to familiar things is common in Scripture. For instance, the Israelites had certainly eaten lamb before the first Passover and Jesus had no doubt eaten bread with his disciples before the first “Lord’s supper,” but those activities acquired special significance as symbols of God’s intervention.

This may be evidence of how God froze the earth prior to Genesis 1:2

2010-10-12T17:15:00.000-07:00

Nanodiamonds Discovered in Greenland Ice Sheet, Contribute to Evidence for Cosmic Impact
ScienceDaily (Sep. 15, 2010) — Nanosize diamonds have been discovered in the Greenland ice sheet, according to a study reported by scientists in a recent online publication of the Journal of Glaciology. The finding adds credence to the controversial hypothesis that fragments of a comet struck across North America and Europe approximately 12,900 years ago.

"There is a layer in the ice with a great abundance of diamonds," said co-author James Kennett, professor emeritus in the Department of Earth Science at UC Santa Barbara. "Most exciting to us is that this is the first such discrete layer of diamonds ever found in glacial ice anywhere on Earth, including the huge polar ice sheets and the alpine glaciers. The diamonds are so tiny that they can only be observed with special, highly magnifying microscopes. They number in the trillions."

This discovery supports earlier published evidence for a cosmic impact event about 12,900 years ago, Kennett explained. He said that the available evidence in the Greenland ice is consistent with this layer being at or close to this age, although further study is needed.

Researchers from the University of Maine led the expedition to Greenland in 2008. Co-authors on the study, besides Kennett and the team from Maine, include scientists from many universities and research entities. James Kennett's son, Douglas J. Kennett, of the University of Oregon, is one of the 21 scientists who contributed to the report.

Last year, the Kennetts reported the discovery of nanosize diamonds in a layer of sediment exposed on Santa Rosa Island, off the coast of Santa Barbara, Calif. They published this information with numerous co-authors in two papers last year in the Proceedings of the National Academy of Sciences and Science magazine.

According to James Kennett, the Greenland results also contradict a recent study questioning the presence of nanodiamonds in a layer of this age.

Kennett explained that the layer containing nanodiamonds on Santa Rosa Island, as well as those in the Greenland ice sheet -- both supporting a cosmic impact event -- appear to closely correspond to the time of the disappearance of the Clovis culture, the earliest well-established and well-accepted human culture living across North America. The event also corresponds with the time of extinction of many large animals across North America, including mammoths, camels, horses, and the saber tooth cat.

There is also evidence of widespread wildfires at that time, said Kennett. An associated sharp climatic cooling called the Younger Dryas cooling is also recorded widely over the northern hemisphere. This includes evidence found in ocean-drilled sediments beneath the Santa Barbara Channel. The cause of this cooling has long been debated as well as the cause of the animal extinctions and human cultural shift.

A high proportion of the nanosize diamonds in the Greenland ice sheet exhibit hexagonal mineral structure, and these are only known to occur on Earth in association with known cosmic impact events, said Kennett. This layer of diamonds corresponds with the sedimentary layer known as the Younger Dryas Boundary, dating to 12,900 years ago.

James Kennett, former director of the Marine Science Institute at UCSB, is considered by many of his peers to be an early founder of marine geology and paleoceanography. He has specialized in analyzing sedimentary layers below the ocean floor.

Consider this article with ice pack of Genesis 1:1 and creation account starting in Genesis 1:2

2010-09-24T17:26:00.000-07:00

New Clue to How Last Ice Age Ended
ScienceDaily (Sep. 8, 2010) — As the last ice age was ending, about 13,000 years ago, a final blast of cold hit Europe, and for a thousand years or more, it felt like the ice age had returned. But oddly, despite bitter cold winters in the north, Antarctica was heating up. For the two decades since ice core records revealed that Europe was cooling at the same time Antarctica was warming over this thousand-year period, scientists have looked for an explanation.

A new study in Nature brings them a step closer by establishing that New Zealand was also warming, indicating that the deep freeze up north, called the Younger Dryas for the white flower that grows near glaciers, bypassed much of the southern hemisphere.

"Glaciers in New Zealand receded dramatically at this time, suggesting that much of the southern hemisphere was warming with Antarctica," said study lead author, Michael Kaplan, a geochemist at Columbia University's Lamont-Doherty Earth Observatory. "Knowing that the Younger Dryas cooling in the northern hemisphere was not a global event brings us closer to understanding how Earth finally came out of the ice age."

Ice core records show that warming of the southern hemisphere, starting 13,000 years ago, coincided with rising levels of the heat-trapping gas, carbon dioxide. The study in Nature is the first to link this spike in CO2 to the impressive shrinking of glaciers in New Zealand. The scientists estimate that glaciers lost more than half of their extent over a thousand years, and that their creep to higher elevations was a response to the local climate warming as much as 1 degree C.

To reconstruct New Zealand's past climate, the study's authors tracked one glacier's retreat on South Island's Irishman Basin. When glaciers advance, they drag mounds of rock and dirt with them. When they retreat, cosmic rays bombard these newly exposed ridges of rock and dirt, called moraines. By crushing this material and measuring the build-up of the cosmogenic isotope beryllium 10, scientists can pinpoint when the glacier receded. The beryllium-10 method allowed the researchers to track the glacier's retreat upslope through time and indirectly calculate how much the climate warmed.

The overall trigger for the end of the last ice age came as Earth's orientation toward the sun shifted, about 20,000 years ago, melting the northern hemisphere's large ice sheets. As fresh melt water flooded the North Atlantic Ocean, the Gulf Stream weakened, driving the north back into the ice age. During this time, temperatures in Greenland dropped by about 15 degrees C. For years, scientists have tried to explain how the so-called Younger Dryas cooling fit with the simultaneous warming of Antarctica that eventually spread across the globe.

The Nature paper discusses the two dominant explanations without taking sides. In one, the weakening of the Gulf Stream reconfigures the planet's wind belts, pushing warm air and seawater south, and pulling carbon dioxide from the deep ocean into the air, causing further warming. In the other, the weakened Gulf Stream triggers a global change in ocean currents, allowing warm water to pool in the south, heating up the climate.

Bob Anderson, a geochemist at Lamont-Doherty who argues the winds played the dominant role, says the Nature paper adds another piece to the puzzle. "This is one of the most pressing problems in paleoclimatology because it tells us about the fundamental processes linking climate changes in the northern and southern hemispheres," he said. "Understanding how regional changes influence global climate will allow scientists to more accurately predict regional variations in rain and snowfall."

Other researchers involved in the study: Joerg Schaefer and Roseanne Schwartz, also of Lamont-Doherty; George Denton and Aaron Putnam, University of Maine; David Barrell, GNS Science, New Zealand; Trevor Chinn, Alpine and Polar Processes Consultancy, New Zealand; Bjørn Andersen, University of Oslo; Robert Finkel, University of California, Berkeley; Alice Doughty, Victoria University of Wellington.

--------------------------------------------------------------------------------

Story Source:

The above story is reprinted (with editorial adaptations by ScienceDaily staff) from materials provided by The Earth Institute at Columbia University.

--------------------------------------------------------------------------------

Journal Reference:

Michael R. Kaplan, Joerg M. Schaefer, George H. Denton, David J. A. Barrell, Trevor J. H. Chinn, Aaron E. Putnam, Bjørn G. Andersen, Robert C. Finkel, Roseanne Schwartz, Alice M. Doughty. Glacier retreat in New Zealand during the Younger Dryas stadial. Nature, 2010; 467 (7312): 194 DOI: 10.1038/nature09313

Some pre-Adamic creatures

2010-09-24T17:11:00.001-07:00

Woolly Mammoth, Woolly Rhinoceros and Reindeer Lived on Iberian Peninsula 150,000 Years Ago, Findings Show
ScienceDaily (Sep. 9, 2010) — A team made up of members of the University of Oviedo (UO) and the Complutense University of Madrid (UCM) have gathered together all findings of the woolly mammoth, the woolly rhinoceros and the reindeer in the Iberian Peninsula to show that, although in small numbers, these big mammals -- prehistoric indicators of cold climates -- already lived in this territory some 150,000 years ago.:

The presence of the woolly mammoth (Mammuthus primigenius), the woolly rhinoceros (Coelodonta antiquitatis), the reindeer (Rangifer tarandus), and to a lesser extent the wolverine (Gulo gulo), the arctic fox (Alopex lagopus), the musk-ox (Ovibos moschatus) and the Saiga antelope (Saiga tatarica), has been linked to the paleoclimatic scale created on the basis of the isotopic composition of oxygen in the ice of Greenland.

"The findings of cold climate fauna in the Iberian Peninsula coincide with the periods of greatest global cooling recorded in the ice of Greenland," Diego Álvarez-Lao, main author of the work and researcher in the Palaeontology Department of the UO explains.

The study, which has been published in the journal Quaternary International, reveals that the oldest remains of mammals adapted to cold climates found in the Iberian Peninsula belong to great prehistoric mammals which lived isolated in Spain 150,000 years ago.

The "glacial fauna" entered the Peninsula at that time because "the environmental conditions in central and northern Europe were so extreme that the animals were obliged to migrate to the south, where the climate was less severe," Álvarez-Lao explains.

44,000 years ago these animals became more common in the Iberian Peninsula but only for periods. "The cold periods (with the presence of glacial fauna) alternated with milder periods," adds the researcher.

The increase in temperatures caused a biological crisis

According to the team, the last findings of these cold species date back some 10,000 years, and coincide with the end of the glaciations. At that time, the climate became warmer in the whole northern hemisphere and the favourable habitat for these faunae was reduced to increasingly more northern latitudes and to smaller spaces.

"The increase in temperatures caused a genuine biological crisis for these animals from extremely cold climates. Some species such as the reindeer and the arctic fox found their new habitat in the arctic regions of the planet, where they still survive today. Others, such as the woolly mammoth and the woolly rhinoceros weren't so lucky," specifies the paleontologist.

According to the studies of pollen remains associated with these findings, the landscape of the period in which the great mammals lived in the Iberian Peninsula comprised mainly of steppes, or herbaceous vegetation. "Trees would have been very scarce in these times of extreme cold and environmental aridity," Álvarez-Lao points out.

The Spanish researchers found the fossil remains of glacial climate fauna in 72 Iberian sites, the majority of which are in the north of the peninsula (Cornisa Cantabrica and Catalonia). There are also some traces in inland areas of the peninsula and even in the south, where the site of the woolly mammoths of Padul (Granada) lies.

"These species lived alongside different human cultures. There is evidence in some sites of the Basque country, Navarra and Catalonia that the Neanderthals coexisted with the mammoths and the reindeer at specific times. However, the majority of evidence of these faunae coincides with the periods of the Gravettian, Solutrean and Magdalenian cultures (during the Upper Paleolithic era in West Europe)," states Álvarez-Lao

Here is another article new findings on the metabolism of dinosaurs:

Body Temperatures of Dinosaurs Measured for First Time: Some Dinosaurs Were as Warm as Most Modern Mammals

Caltech geochemists Rob Eagle (left) and John Eiler adjust equipment used to analyze the isotopic concentrations in dinosaur teeth and reveal the body temperature of the extinct creatures. (Credit: Caltech / Lance Hayashida)ScienceDaily (June 23, 2011) — Were dinosaurs slow and lumbering, or quick and agile? It depends largely on whether they were cold or warm blooded. When dinosaurs were first discovered in the mid-19th century, paleontologists thought they were plodding beasts that had to rely on their environments to keep warm, like modern-day reptiles. But research during the last few decades suggests that they were faster creatures, nimble like the velociraptors or T. rex depicted in the movie Jurassic Park, requiring warmer, regulated body temperatures like in mammals.
Now, a team of researchers led by the California Institute of Technology (Caltech) has developed a new approach to take body temperatures of dinosaurs for the first time, providing new insights into whether dinosaurs were cold or warm blooded. By analyzing isotopic concentrations in teeth of sauropods, the long-tailed, long-necked dinosaurs that were the biggest land animals to have ever lived -- think Apatosaurus (also known as Brontosaurus) -- the team found that the dinosaurs were about as warm as most modern mammals.
"This is like being able to stick a thermometer in an animal that has been extinct for 150 million years," says Robert Eagle, a postdoctoral scholar at Caltech and lead author on the paper to be published online in the June 23 issue of Science Express.
"The consensus was that no one would ever measure dinosaur body temperatures, that it's impossible to do," says John Eiler, a coauthor and the Robert P. Sharp Professor of Geology and professor of geochemistry. And yet, using a technique pioneered in Eiler's lab, the team did just that.
The researchers analyzed 11 teeth, dug up in Tanzania, Wyoming, and Oklahoma, that belonged to Brachiosaurus brancai and Camarasaurus. They found that the Brachiosaurus had a temperature of about 38.2 degrees Celsius (100.8 degrees Fahrenheit) and the Camarasaurus had one of about 35.7 degrees Celsius (96.3 degrees Fahrenheit), warmer than modern and extinct crocodiles and alligators but cooler than birds. The measurements are accurate to within one or two degrees, Celsius.
"Nobody has used this approach to look at dinosaur body temperatures before, so our study provides a completely different angle on the longstanding debate about dinosaur physiology," Eagle says.
The fact that the temperatures were similar to those of most modern mammals might seem to imply that dinosaurs had a warm-blooded metabolism. But, the researchers say, the issue is more complex. Because large sauropod dinosaurs were so huge, they could retain their body heat much more efficiently than smaller mammals like humans. "If you're an animal that you can approximate as a sphere of meat the size of a room, you can't be cold unless you're dead," Eiler explains. So even if dinosaurs were "cold blooded" in the sense that they depended on their environments for heat, they would still have warm body temperatures.
"The body temperatures we've estimated now provide a key piece of data that any model of dinosaur physiology has to be able to explain," says Aradhna Tripati, a coauthor who's an assistant professor at UCLA and visiting researcher in geochemistry at Caltech. "As a result, the data can help scientists test physiological models to explain how these organisms lived."
The measured temperatures are lower than what's predicted by some models of body temperatures, suggesting there is something missing in scientists' understanding of dinosaur physiology. These models imply dinosaurs were so-called gigantotherms, that they maintained warm temperatures by their sheer size. To explain the lower temperatures, the researchers suggest that the dinosaurs could have had some physiological or behavioral adaptations that allowed them to avoid getting too hot. The dinosaurs could have had lower metabolic rates to reduce the amount of internal heat, particularly as large adults. They could also have had something like an air-sac system to dissipate heat. Alternatively, they could have dispelled heat through their long necks and tails.
Previously, researchers have only been able to use indirect ways to gauge dinosaur metabolism or body temperatures. For example, they infer dinosaur behavior and physiology by figuring out how fast they ran based on the spacing of dinosaur tracks, studying the ratio of predators to prey in the fossil record, or measuring the growth rates of bone. But these various lines of evidence were often in conflict. "For any position you take, you can easily find counterexamples," Eiler says. "How an organism budgets the energy supply that it gets from food and creates and stores the energy in its muscles -- there are no fossil remains for that," he says. "So you just sort of have to make your best guess based on indirect arguments."
But Eagle, Eiler, and their colleagues have developed a so-called clumped-isotope technique that shows that it is possible to take body temperatures of dinosaurs -- and there's no guessing involved. "We're getting at body temperature through a line of reasoning that I think is relatively bullet proof, provided you can find well-preserved samples," Eiler says. In this method, the researchers measure the concentrations of the rare isotopes carbon-13 and oxygen-18 in bioapatite, a mineral found in teeth and bone. How often these isotopes bond with each other -- or "clump" -- depends on temperature. The lower the temperature, the more carbon-13 and oxygen-18 tend to bond in bioapatite. So measuring the clumping of these isotopes is a direct way to determine the temperature of the environment in which the mineral formed -- in this case, inside the dinosaur.
"What we're doing is special in that it's thermodynamically based," Eiler explains. "Thermodynamics, like the laws of gravity, is independent of setting, time, and context." Because thermodynamics worked the same way 150 million years ago as it does today, measuring isotope clumping is a robust technique.
Identifying the most well-preserved samples of dinosaur teeth was one of the major challenges of the analysis, the researchers say, and they used several ways to find the best samples. For example, they compared the isotopic compositions of resistant parts of teeth -- the enamel -- with easily altered materials -- dentin and fossil bones of related animals. Well-preserved enamel would preserve both physiologically possible temperatures and be isotopically distinct from dentin and bone.
The next step is to take temperatures of more dinosaur samples and extend the study to other species of extinct vertebrates, the researchers say. In particular, taking the temperature of unusually small and young dinosaurs would help test whether dinosaurs were indeed gigantotherms. Knowing the body temperatures of more dinosaurs and other extinct animals would also allow scientists to learn more about how the physiology of modern mammals and birds evolved.
In addition to Eagle, Eiler, and Tripati, the other authors are Thomas Tütken from the University of Bonn, Germany; Caltech undergraduate Taylor Martin; Henry Fricke from Colorado College; Melissa Connely from the Tate Geological Museum in Casper, Wyoming; and Richard Cifelli from the University of Oklahoma. Eagle also has a research affiliation with UCLA.
This research was supported by the National Science Foundation and the German Research Foundation.

Story Source:
The above story is reprinted (with editorial adaptations by ScienceDaily staff) from materials provided by California Institute of Technology. The original article was written by Marcus Woo.

Journal Reference:
Robert A. Eagle, Thomas Tütken, Taylor S. Martin, Aradhna K. Tripati, Henry C. Fricke, Melissa Connely, Richard L. Cifelli, John M. Eiler. Dinosaur Body Temperatures Determined from Isotopic (13C-18O) Ordering in Fossil Biominerals. Science, 2011; DOI: 10.1126/science.1206196
Need to cite this story in your essay, paper, or report? Use one of the following formats:
APA

MLA
California Institute of Technology (2011, June 23). Body temperatures of dinosaurs measured for first time: Some dinosaurs were as warm as most modern mammals. ScienceDaily. Retrieved June 26, 2011, from http://www.sciencedaily.com; /releases/2011/06/110623141312.htm
Note: If no author is given, the source is cited instead.
Disclaimer: Views expressed in this article do not necessarily reflect those of ScienceDaily or its staff.

Secular Article about new fossils not really proving anything

2010-09-13T08:46:00.000-07:00

ScienceDaily (Sep. 1, 2010) — Palaeontologists are forever claiming that their latest fossil discovery will "rewrite evolutionary history." Is this just boasting or does our "knowledge" of evolution radically change every time we find a new fossil?

A team of researchers at the University of Bristol decided to find out, with investigations of dinosaur and human evolution. Their study, which is published in Proceedings of the Royal Society B, suggests most fossil discoveries do not make a huge difference, confirming, not contradicting our understanding of evolutionary history.

This is especially true of the fossil record of human origins from their primate relatives. Even though early human fossils are immensely rare, and new discoveries make a big splash in the scientific literature and in the media, they sit randomly across the evolutionary tree of early humans. In other words, most discoveries of new fossil species simply fill in gaps in the fossil record that we already knew existed.

As Dr James Tarver, leader of the study, said: "Human fossils are very rare, and they are costly to recover because of the time involved and their often remote locations. Scientists may be pushed by their sponsors, or by news reporters, to exaggerate the importance of their new find and make claims that 'this new species completely changes our understanding'."

The story of dinosaur evolution is a bit more complicated. New dinosaur fossils are being found in places around the world where they've never been looked for before, such as China, South America and Australia. These fossils are fundamentally challenging existing ideas about dinosaur evolution but this seems to tell us that there are still many new species of dinosaurs out there in the rocks.

"These are important results," said Professor Michael Benton, another member of the team. "It might seem negative to say that new finds do, or do not, change our views. However, to find that they don't means that we may be close to saturation in some areas, meaning we know enough of the fossil record in some cases to have a pretty good understanding of that part of the evolutionary tree."

Professor Phil Donoghue commented further: "We can use these studies as a way of targeting new expeditions. If dinosaurs are poorly understood from a particular part of the world, or if some other group is altogether incompletely known, that's where we need to devote greater efforts."

Story Source:

The above story is reprinted (with editorial adaptations by ScienceDaily staff) from materials provided by University of Bristol.

--------------------------------------------------------------------------------

Need to cite this story in your essay, paper, or report? Use one of the following formats:
APA

MLA University of Bristol (2010, September 1). Evolution rewritten, again and again. ScienceDaily. Retrieved September 13, 2010, from http://www.sciencedaily.com /releases/2010/08/100831190028.htm
Note: If no author is given, the source is cited instead.

2010-09-02T21:10:00.001-07:00

Research Notes

THE
PRE-ADAMIC
FLOOD

&
RESOURCES SUPPORTING
THE GAP THEORY

(an introduction to the gap theory)

By C White
Version 2.3

-

“Perhaps the most ardent 20th century spokesmen of the gap
theory were televangelist Herbert W. Armstrong (1892-1986)
and his son Garner Ted Armstrong. Herbert Armstrong found
the Scofield account compelling and incorporated it as part of
his own teachings and ultimately the theory became part of "the
truth" taught on The World Tomorrow radio and television
programs and in The Plain Truth … The program had millions
of listeners and viewers for about 35 years (1950-1985). With
the end of The World Tomorrow program, basically its single
mass media proponent, the theory began to decline. Scientific
creationism became increasing militant and fiercely argued
against it. Nevertheless, it has enjoyed some resurgence with
the republishing of the Scofield Study Bible and the Dake
Bible.” (see appendix 2 for further information).”

(quoted from http://www.bibarch.com/)

The Pre-Adamic Flood & Resources Supporting the Gap Theory

Contents

Introductory Comments.................................................................................................4
Recommended Resources...........................................................................................5
The Pre-Adamic Flood and the Creation of Man......................................................7
Pointing to 4,000 BC....................................................................................................10
Concluding Comments................................................................................................12
Bibliography and Suggested Reading ......................................................................13
Appendix One: Another Time. Another Place. Another man...............................15
Appendix Two: Did God Create a Devil? ................................................................17
Appendix Three: Armstrong Gap Theory................................................................23
Appendix Four: Questions and Answers.................................................................27
Appendix Five: Inner Earth May Hold More Water Than the Seas.....................30

History Research Projects

GPO Box 864, Sydney, Australia 2001

www.originofnations.org

No limitation is placed upon reproduction of this document except
that it must be reproduced in its entirety without modification or
deletions. The publisher's name and address, copyright notice and
this message must be included. It may be freely distributed but
must be distributed without charge to the recipient.

3

The Pre-Adamic Flood & Resources Supporting the Gap Theory

Introductory Comments

Recently I thought it high time for me to assemble at least some data or pointers
toward research for those wishing to delve a little deeper into the ‘gap theory’. I wish I
had the time to type up a reasonable article on the subject, but time fails me at the
present time.

What is the gap theory anyway? First of all let us turn to Genesis itself where we read:

“In the beginning God created the heaven and the earth.
And the earth was [Heb. haja = had become] without form, and void;
and darkness was upon the face of the deep. And the Spirit of God
moved upon the face of the waters.” (Gen 1:1-2)

In a nutshell, Genesis 1:1 is understood to be a time of the original creation of the
universe. But verse 2 through to 2:1 is about the restoration of the earth in preparation
for creation of man and subsequent events – so there would be considerable time
between the two verses.

And the chaos that ensued is attributable to Lucifer’s insurrection. Indeed, there are
many books out there these days which attribute broken planets and the various
asteroids and meteorite remnants to a great inter-galactic battle or even a series of
battles.

For decades, probably since the 1930s, Herbert W Armstrong recognised the original
Hebrew meaning for Genesis 1 and its true intent. He wrote about this in the article
“Did God create a devil?” where this issue is explained very well (see appendix 1)

In fact, one website (http://www.bibarch.com/) recognises the influence of the old WCG
and the Armstrong’s in spreading and teaching this truth:

“Perhaps the most ardent 20th century spokesmen of the gap theory
were televangelist Herbert W. Armstrong (1892-1986) and his son
Garner Ted Armstrong. Herbert Armstrong found the Scofield account
compelling and incorporated it as part of his own teachings and
ultimately the theory became part of "the truth" taught on The World
Tomorrow radio and television programs and in The Plain Truth … The
program had millions of listeners and viewers for about 35 years (19501985).
With the end of The World Tomorrow program, basically its
single mass media proponent, the theory began to decline. Scientific
creationism became increasing militant and fiercely argued against it.
Nevertheless, it has enjoyed some resurgence with the republishing of
the Scofield Study Bible and the Dake Bible.” (see appendix 2 for
further information)

Without this doctrine (a better word we should use in lieu of “theory”), we lose certain
truths and how God worked in ancient times. It is an essential truth under attack – we
have a right and an obligation to both defend our beliefs and to aggressively propagate
them.

The old WCG published other articles on the subject such as “How long were the days
of creation?” by Kenneth Herrmann (1958), “Geology Reveals: Two Creations - Two
Worldwide Floods” by Lynn Torrance (1964).

4

The Pre-Adamic Flood & Resources Supporting the Gap Theory

In the 1970s Dr Hoeh and others such as Richard Burky (Creative Development. A
Better Explanation than Organic Evolution) developed this belief and provided further
detail. See also the exchange of letters between Dr Hoeh and Kenneth Herrmann
which may be found at http://www.friendsofsabbath.org/ABC.htm which contain more
insights into their thinking and research.

Noah and his ark

Recommended Resources

While the traditional view of six literal days of creation is overwhelmingly prevalent
because the various ‘creation science’ organisations are in almost total control of the
pertinent publishers and websites and oppress those who believe in an ancient earth
and universe, there are a number of useful websites and books demonstrating the ‘gap’
point of view. Here are some of them:

•
http://www.bibarch.com/ contains much excellent materials
•
Another excellent website containing very useful resources is
http://www.christiangeology.com/gap_theory.html

•
A further resource is http://www.creationdays.dk/index.php
•
Of course there are many other fine resources which are available to the
inquiring mind such as http://www.gospelcenterchurch.org/Gaptheory.html and
http://www.ichthys.com/sr2-copy.htm and many others.
Then there are books such as Another Time, Another Place, Another Man by Finis
Dake (Mark Allison and David Patton (eds)); The Genesis Debate : Three Views on the
Days of Creation by David Hagopian (ed) and Christianity and the Age of the Earth by
Davis Young are worth reading.

Dake’s book removes the tension between science and Christianity on the age of the
earth and explores the pre-Adamic world. We may not agree with everything contained
within it, but it is very useful to our overall studies. See appendix one for further
information.

The Genesis Debate presents a fair account of the three major theories on the creation
days and pairs authors from these authors to dialog and debate these theories. These
views are: the young creation theory (24 hour literal days); day-age theory (the earth is

5

The Pre-Adamic Flood & Resources Supporting the Gap Theory

old and created over six major epochs); and the framework theory (ie Genesis chapter
one represents an expression of literary but real events that are not in sequence.

In the foreword, Norman Giesler states a wisdom that all should inculcate:

"the creation-day debate is not over the inspiration of the Bible, but over
it's interpretation ... no one holding any of the views should be charged
with unorthodoxy for the position he espouses in this volume … the
Church needs to shift its focus to the real enemy - evolutionism - not to
other forms of creationism that remain true to the historicity of the
events recorded in Genesis".

The orthodoxy of 24 hour literal days of creation which is espoused by evangelicals and
Pentecostals must be resisted by the Churches of God. These streams of Christianity
hold control over the institutions and publishers on this important Biblical subject.
Alternative viewpoints have a difficult time being heard or getting published. It is
therefore difficult to find their books, websites and there are probably no DVDs by
them.

Yet we must solider on with the truth.

Another work which is worth ploughing through is The Day Behemoth and Leviathan
Died by David Allen Deal.

Deal argues that Behemoth is a brontosaurus and Leviathan was a tyrannosaurus rex
or similar which were wiped out in a huge earth-wide cataclysm that impacted the earth

– the first of two massive catastrophic events in earth history. This pre-dated man and
the dinosaurs did not dwell on the earth at the same time as humans according to Deal.
He also argues for a second catastrophe that occurred at a much later time at the time
of Noah – a worldwide, devastating flood that destroyed the old world. While one does
not need to accept everything the book postulates, it is most interesting that he does
perceive two major catastrophes in the distant pass.1

Davis Young in his Christianity and the Age of the Earth believes that the credibility of
Christianity is being damaged by the young earth advocates and their limited scientific
ability or honesty. This is turn would hinder evangelistic outreach.

His book is divided into three parts: part 1 – provides an overview of Christian thought
on the age of the earth debate; part 2 – discusses the flood, radiometric dating,
sedimentation, stratigraphy and so on; part 3 – contends that the young earth theory
does not match the Biblical or scientific facts.

I have many, many other fascinating items on the subject and plenty of personal
research and notes. Once I dig them out of a box, I shall write an article on the subject.
In the meantime, the information below may serve as an introduction to what I hope to
write on.

1 However, inexplicably, he places the Holocene at the time of Noah rather than prior to Adam.

6

The Pre-Adamic Flood & Resources Supporting the Gap Theory

Modern-day floodings are tiny compared to both the pre-Adamic and Noahician floods

The Pre-Adamic Flood and the Creation of Man

The experts themselves are confused about racial origins. For example, some feel that
the Africans evolved from the primates of Africa, while others feel they migrated out of
Asia after evolving there. Concerning the Australian Aboriginals, some feel they
evolved in Australia isolated from Asia, others feel they migrated to Australia 40,000
years ago, while still others say that this migration occurred 10,000 or even 4,000 years
ago. Why such confusion? Simply because they ignore the Word of God and
secondly, they confuse the pre-Flood races with post-Flood races, believing that there
are no terminating points between these periods, but instead that these various periods
run fluidly into each other. If only they read and believed the Bible.

But the Bible tells us that great flooding occurred prior to the creation of Adam and then
later at the time of Noah:

“and darkness was upon the face of the deep [waters covering the
earth]. And the Spirit of God moved upon the face of the waters”
(Gen. 1:2).

During the time of Noah, another great flood struck the earth:

“and, behold, I, even I, do bring a flood of waters upon the earth, to
destroy all flesh, wherein is the breath of life, from under heaven; And
everything that is in the earth shall die" (Gen. 6:17)

Legends from all over the globe attest to this great flood.2

Repeatedly, the earth has been engulfed in enormous upheavals which consign
scenes from gripping movies such as Volcano and Dante’s Peak to mere blips.
Scientists reckon immense devastation and catastrophism upon the earth occur at
regular, virtually cyclical periods.

In Genesis 1:1-2 we are told:

“In the beginning God created the heavens and the earth. And the
earth was [became] without form and void; and darkness was upon the
face of the deep. And the Spirit of God moved upon the face of the
waters”

Several matters may be teased out of this scripture which we generally seldom hear
about. Firstly, philological studies of “moved” is taken to mean “to brood” like a bird or
dove fluttering over his offspring. Others feel that there may be an inference here to
hover or coast in the air like an eagle (compare Deut 32:11). Here we find God showing
great care for the re-forming of the earth prior to the creation of humankind. What

2 See Dankenbring:1978: ch.3

7

The Pre-Adamic Flood & Resources Supporting the Gap Theory

happened prior to Adam’s creation?

If we are to accept dating methodologies indicating that the earth is about 4.6 billion
years old, God was indeed active in creative expression long prior to creation of man. It
would seem that God may have been busy with various physical creative expressions
over a long time. Here are some of the biochronological eras or epochs which we are
told earth history may be divided into (I use them here for sake of argument and do not
enter into debates about the dating of the age of the earth and related issues):

•
Archeozoic Proterozoic (the Precambrian era -4.6 billion to 600 millions
years ago)
•
Paleozoic (including the Cambrian, Orovician, Silurian, Devonian,
Carboniferous, Permian eras - 600-230 million years ago)
•
Mesozoic (including the Triassic, Jurassic and Cretaceous eras - 230- 67
million years ago)
•
Cenozoic (Tertiary and Quaternary eras – 67 million years ago to recent
times).
The Quaternary era consists of the Pleistocene and Holocene periods. The Pleistocene
period was a time when the earth experienced an horrific Ice Age followed by
tremendous flooding during the Holocene period.3 The Holocene commenced about
11,000 BC and ended about 4,000 BC (please note that there was enormous flooding,
but the entire globe was not subdued with water on this occasion).4 Entire species were
extinguished and the world experienced immense upheaval.5 Scientists have shown
that deserts arose after 4,000 BC.6 The land bridges between Australia and both
Papua New Guinea and Tasmania; and between Siberia and Alaska disappeared at
that time, never to be recovered.

In this light a recent publication piqued the interest of many people: scientists,
catostrophicists, creationists and the lay reader. The work, Noah’s Flood. The New
Scientific Discoveries about the event that changed history, claims to have found
evidence for a great flooding in the Near East. They claim that this gave rise to legends
of Noah’s flood. As we shall see, this discovery actually refers to the pre-Adamic
flooding.

During a time we would agree to be the pre-Flood world, mankind spread across the
earth from it’s heart in the Middle East – in a similar fashion to the way it did in the
post-Flood world. Races and nations that were extant prior to the Flood, continued, in
many case, via Noah’s three sons, after the Flood:

3 This is also the period that the famous Vela X supernova – around 11,400BC. See
http://xxx.lanl.gov/abs/astro-ph/99022304 These periods are referred to if we were to accept modern dating techniques and are used for the sake of
argument. See Thom & Chappell 1975: 90-93.
5 See Allan & Delair’s book When the Earth Nearly Died. In it they assemble powerful arguments from
biology, palaeontology and geology to prove that there was huge upheaval all over the earth. Rapid,
violent seismic conditions prevailed. Was this a time of rebellion for Satan followed by God steadying the
earth and readying it for the creation of man? They even state: “We do urge, however, that a high
percentage of today’s major ranges rose to their present heights only at the end of, or after, Pleistocene
times … The geological modernity of folded mountains in many parts of Asia was recognisable early this
century by Dr Bailey Willis when he wrote how they “challenge credulity by their extreme youth.” His
conclusions were confirmed by studies of mountain ranges in China, where huge uplifts of the Earth’s crust
were found to have occurred since the glacial period.” (pp 25-26)
6 They still cannot explain how the temperate zones spread across the earth at the end of the ice age and
then suddenly, around 4000BC, the temperate zones retreated. Deserts then arose. For further evidence
go to http://www.detailshere.com/letters2.htm

8

The Pre-Adamic Flood & Resources Supporting the Gap Theory

“From one single region, the Middle East on Cavalli-Sforza’s map,
sprung all the colonizer’s who brought farming to Palestine,
Mesopotamia, Persia, India, Anatolia, Europe, Ukraine, and even Egypt
… he had shown that the branchings of the genetic tree conformed quite
precisely to those of the linguistic tree.”7

When the world was peopled after the Flood, Noah’s descendants from his three sons
mutated into the races and developed into nations and tribes. They more-or-less
occupied the same areas as similar pre-Flood folk. They would have even rebuilt pre-
Flood cities and perhaps, used whatever artifacts they found.

In any event, when this book hit the bookshelves, it quickly became a hot seller leading
to a number of articles published all over the world and a television documentary.

The author’s argue for a persistent and massive outflow of water from the Black Sea
toward the end of the Holocene period. Their scientific analysis included using coring
devices and sound waves to probe the bottom of the Sea. The result? A discovery that
the Black Sean was once a large inland sea which lay below the ocean’s – probably
hundreds of feet below ocean level. This is confirmed by later research by Robert
Bollard who used sonar to capture images of the old shoreline – way below its current
limit.8

The Black Sea prior to its flooding

But the oceans of the world were rising due to the glacial melt – now they rose and
burst into the Black Sea via the Bosporus– the consequent meeting and then rise of the
Black Sea resulted in terrible surges that smashed into the surrounding regions.

The deluge was apocalyptic, submerging thousands of square miles, killing species
and altering the ecosystem from fres hwater to saltwater very rapidly.

They do not believe in a worldwide Flood, but in a Holocene sea-level rise and
spillages or tremendous floodings into the Middle East which, in their opinion, produced
the Noahcian flood legend. They are clearly on to something.

7 Ryan & Pitman 1999: 1088 Gugliotta 1999 “For Noah’s Flood, a New Wave of Evidence”. See also Issar 2003

9

The Pre-Adamic Flood & Resources Supporting the Gap Theory

The Washington Post notes:

“But while Ryan and Pitman do not prove that the Black Sea flood
directly inspired Gilgamesh or Noah, their theory argues persuasively
that the event was probably horrific enough for scribes and minstrels to
remember it for thousands of years.”9

But alas! If only they would use Bible dating methods and used it is a template, they
would realise that this flooding occurs approximately 3,000 years too early. Instead,
what they have discovered is a local flooding that was a part of the pre-Adamic flooding
associated with the Holocene.

Cover jacket for Ryan & Pitman’s book

Pointing to 4,000 BC

The Bible is adamant that man was created around 4,000 BC (probably about 3960
BC) – it is from that time onwards that many scientists acknowledge civilization and
knowledge began to emerge.

One source (the Encyclopaedia of Aboriginal Australia10) actually states that “sea-
levels rose continuously until around 6,000 years ago” which is about 4,000BC, when
man was created!

One example may be found at Susa, its lowest levels show traces of human occupation
about 4,000BC, which fits nicely into the Biblical dating model of creation of man
c4000BC (see The New International Dictionary of Biblical Archaeology, art. “Crafts,
Craftsmen”).11 Researchers also claim that it was getting toward 6,000 years ago, at
the end of the Ice Age, that the pagan rainbow serpent art first appeared in Australia –
in Arnhem Land. I have before me an article on this published in the Sydney Morning
Herald:

“… the first drawings were inspired directly by climate change which
dramatically reshaped the globe, beginning about 6,000 years ago …
[the drawings continued in phases one which occurred] … (6,000 to
4,000 years ago) the “Yam” style for its focus on yams, waterlilies and
other food plants …

“Most of Australia is covered by one basic [Aboriginal] language

9 ibid
10 Encyclopaedia of Aboriginal Australia, vol 1, 1994, p 473. See also Archaeology of the Dreamtime by
Josephine Flood, 1983, page 123)
11 The New International Dictionary of Biblical Archaeology, art. “Crafts, Craftsmen”, page 139

10

The Pre-Adamic Flood & Resources Supporting the Gap Theory

group, but in the Arnhem Land-Gulf of Carpentaria area something
like 60 different languages in about 26 language groups are, or were,
spoken,” says Mulvaney, the author in 1969 of The Prehistory of
Australia, the first book on the subject …

“But by 6,000 years ago things had escalated. Large-scale battle
scenes appear for the first time.”12

So, once again, we have reference to 6,000 years ago for the sudden rise in certain art,
weapons and such like. In other words shortly after Adam’s creation almost 4,000 BC.
How early the pre-flood world went into paganism which was continued into the post-
Flood world.

Is there inference in Genesis 1:1-2 of the end of the Holocene period with God
intervening to reverse the great flooding all over the earth in readiness for conditions
for human existence? This may indeed be the case; and if it is, it may give credence to
the theory that God cleanses the planet prior to creative activity. He is the God of fiat
creation, not a God guiding evolutionary development. As such, He may determine to
create at various times, according to His great will and wisdom.

He created man after readying the earth for him at the end of the Holocene period. But
this was not the last time God ‘baptised’ and cleansed the earth – it happened again
about 1,600 years later at the great flood of Noah.

Note what others such as Muller and MacDonald in their work Ice Ages and
Astronomical Causes, have to say about this period around 4,000BC:

“The abruptness of the termination is startling. Agriculture, and all of
our civilization, developed since this termination. The enormous
glacier, several kilometers thick, covering much of North America and
Eurasia, rapidly melted. Only small parts of this glacier survived in
Greenland and Antarctica, where they exist to this day. The melting
caused a series of worldwide floods unlike anything previously
experienced by Homo sapiens.

… The flood dumped enough water into the oceans to cause the
average sea level to rise 110 meters, enough to inundate the coastal
areas… The water from melting ice probably flooded down over land
in pulses, as ice-dammed lakes formed and then catastrophically
released their waters.”13 [emphasis mine]

There can be no doubt about it, there was a global flooding covering much of the
earth’s surface accompanied by various upheavals prior to Adam – seemingly readying
the earth for human habitation.

Let us take notice of other sources of information on major occurrences that occurred
around 4,000BC that I have managed to find or merely come across during casual
reading of newspapers or journals.

12 Dayton 1996 “Scientists find religion in ancient Aboriginal rock art”, Sydney Morning Herald13 Muller & MacDonald 2000:4. And according to Ancient Mesopotamia: “Mesopotamia is, geologically
speaking, a trough created as the Arabian shield has pushed up against the Asiatic landmass, raising the
Zagros Mountains and depressing the land to the southwest of them. Within this trench, the Tigris and the
Euphrates Rivers and their tributaries have laid down enormous quantities of alluvial sediments, forming
the Lower Mesopotamian Plain (also known as the alluvial Mesopotamian plain). Today the Lower
Mesopotamian Plain stretches some 700 kilometers, from approximately the latitude of Ramadi and
Baquba in the northwest to the Gulf, which has flooded its southeastern end.” (1999: 29)

11

The Pre-Adamic Flood & Resources Supporting the Gap Theory

John Noble Wilford wrote an article on “Ruins alter ideas of how civilization spread”.
Wilford describes how ruins have been found southern Turkey which may be dated to
more than 5,500 years ago. It shows that the protective wall around the city and the
artefacts combine to show that there was a complex government in place even at that
period of time.

“Digging into the oldest layer of ruins uncovered so far, archaeologists
found traces of people living in villages at the site as early as 4000
B.C.”14

So here we have specialists demonstrating that it did not take long for Adam’s
descendants to build complex societies. This would come as no surprise to students of
the book of Genesis.

A few hundred miles away at Susa, a city in the Iranian province of Khuzestan. After
Noah’s flood it became the capital of the Elamites (where Daniel and Nehemiah
resided during the Babylonian captivity).

It is here that the lowest levels may be traced back to 4000 BC15. Just another
coincidence? Just to the north, in central Asia, scientists have uncovered a civilization
as old as Sumeria that dates back similarly.16 All of this points to the rise of civilization
after Adam and Eve’s creation.

Then we can turn our attention to a tropical land thousands of kilometres from Iran.
There in Indonesia scientists find evidence that “beginning around 4000 B.C.” the area
began to be populated.17

Similarly, a city has been discovered dating back prior to the Indus Valley or Harrapan
civilization (which arose 2300-2000 BC). The city is dated back to 3300-2800BC –
again, in the period after Adam’s creation and prior to Noah’s flood.18

Even in pre-Flood Britain we find evidence of the world’s oldest road dated to 6,000
years ago and “in about 4,000 B.C. the first farmers of Britain began arriving from the
European mainland.”19

Concluding Comments

So even many scientists, using their dating methodology, notice that human
civilizations began to appear after 4,000BC or thereabouts.

It is also of major interest that there were great floodings upon the earth just
prior to 4,000BC, fitting in with the Holocene period.

So, from all the evidence, it would certainly seem that the “waters’ referred to in
Genesis 1:2 is reference to that period.

14 Wilford 2000 “Ruins alter ideas of how civilization spread”. A similar article was published by W Mullen in
the Chicago Tribune, also mentioning 4,000 BC.
15 Blaiklock & Harrison: 139
16 Howe 2001. The Supe Valley civilization in Peru was extant at the same time as that in central Asia,
Mesopotamia, and Egypt providing glimpses into the pre-Flood world17 Peacock 1973: 5. Similarly there was a major migration into Melanesia, Micronesia and Polynesia 5,000
to 7,000 years ago (approximately) according to an article I have by Kimihro Muraoka 1993:3-918 Rahman, T c1996:1
19 Coles 1989:79

12

The Pre-Adamic Flood & Resources Supporting the Gap Theory

Bibliography and Suggested Reading

Allan, DS (1994)
& Delair, JB

Allison, M (1997)
& Patton, D (eds)
Armstrong, HW (1958)

Blaiklock, E (1983)
& Harrison, R
Blaiklock, EM (1983)
& Harrison, RK, eds
Coles, JM (1989)

Dankenbring, WF (1978)
Dake, F (1997)

Dayton, L (1996)

Deal, D (1999)

Flood, J (1983)
Gentet, RE (1973)
Germano, MP (c2004)
Gugliotta, G (1999)

Hagopian, DG (2001)

Herrmann, K (1958)
Horton, D (1994)

Howe, LM (2001)

Issar, AS (2003)

Mullen, W (2001)

Muller, R (2000)
& MacDonald GJ (eds)
Muraoka, K (1993)

Peacock, IL (1973)

Pollock, S (1999)
Rahman, T (c1996)

When the Earth Nearly Died. Compelling Evidence of a
Catastrophic World Change 9,500 BC”, Gateway Books, Bath,
England

Another Time, Another Place, Another Man, Dake Publishing

“Did God Create a Devil?”, Plain Truth, Nov (original published in
1954, reprinted in 1971)

The New International Dictionary of Biblical Archaeology.
Zondervan Publishing House, Michigan

The New International Dictionary of Biblical Archaeology, art.
“Crafts, Craftsmen”, Grand Rapids: Zondervan

“The World’s Oldest Road”, Scientific American, November: 7984

Beyond Star Wars. Triumph Publishers, Pasadena
Another Time. Another Place. Another Man. Dake Publishing,
Lawrenceville, Georgia (edited by M Allison and D Patton)

“Scientists find religion in ancient Aboriginal rock art”, Sydney

Morning Herald, 26 October
The Day Behemoth and Leviathan Died. Kherem La Yah Press,
Vista, California

Archaeology of the Dreamtime. Collins, Sydney
“Noah’s Flood -Is it believable?”, Good News , Dec: 21-24
Armstrong Gap Theory, http://www.bibarch.com/

“For Noah’s Flood, a New Wave of Evidence”, Washington Post,

18 November
The Genesis Debate. Three Views on the Days of Creation. Crux
Press, Mission Viejo, California.

“How long were the days of creation?”, Plain Truth, Dec.
Encyclopaedia of Aboriginal Australia, vol 1, Aboriginal Studies
Press, Canberra.

Archaeologists Find Central Asia Civilization as Old as Sumeria.

Philadelphia, Pennsylvania

Climate Changes during the Holocene and their Impact on
Hydrological Systems. The Hebrew University of Jerusalem,
Cambridge University Press, New York

“Buried city shakes up archaeological thinking”, Chicago Tribune,

6 July
Ice Ages and Astronomical Causes. PraxisPublishing Ltd,
Chichester, England

"The Mongoloids Surrounding the Pacific Basin", Pacific Friend.
Vol 21, no.3, July: 3-9

Indonesia: An Anthropological Perspective. Goodyear Publishing,
Co
Ancient Mesopotamia. Cambridge

Peoples and Languages in Pre-Islamic Indus Valley (internet
article)

13

The Pre-Adamic Flood & Resources Supporting the Gap Theory

Ryan, W (1999)
Noah’s Flood. The New Scientific Discoveries about the event
that changed history. Simon & Schuster, New York

& Pitman, W
Science archive website http://xxx.lanl.gov/abs/astro-ph/9902230 (re Vela X)
Thom, BG (1975) “Holocene Seal Levels Relative to Australia”, Search, Vol. 6, No.

3, March: 90-93

Chappell, J

Torrance, L (1964)
“Geology Reveals: Two Creations - Two Worldwide Floods”,
Plain Truth, Feb

Wilford, JN (2000)
“Ruins alter ideas of how civilization spread”, New York Times,
25 May

Young, D (1988)
Christianity and the Age of the Earth. Artisan Publishers, Ca.

14

The Pre-Adamic Flood & Resources Supporting the Gap Theory

Appendix One

Another Time. Another Place. Another man
Chapter One: In the Beginning

by Finis Jennings Dake
1977

In The Beginning

Long before a man called Adam walked with God in the gardens of Eden, longer still
before the flood of Noah covered the face of the earth, in a time called "the beginning,"
God created the heavens and the earth. A grand and beautiful design, the earth as
conceived by the Creator was an exquisite home for the creatures He had fashioned.
The earth itself was a magnificent garden where life flourished in a dazzling display of
variety. The ground trembled with the footsteps of the largest creatures (those we now
call dinosaurs). Animals filled the trees, the skies and the oceans. From eternity God
had planned this creation, and it was perfect in every way. God created men and they
began to settle in villages, cities and nations. Angels, a part of this new creation, were
given dominion over the earth, to rule with the authority of their Creator. It was the
archangel Lucifer who ruled over the nations in all the splendor of the greatest of God's
creations. Every creature fashioned by the hand of God acted in perfect obedience to
the will of their Creator. Angels and men knew God as a friend and drew their life from
Him. There was no sickness or disease, no hunger or death, for there was no sin—

--Until Lucifer, the closest to the throne of God, the archangel who "walked up and
down in the midst of the stones of fire," let the seed of pride find fertile ground in his
heart. Pride led to rebellion, and rebellion to judgment. Lucifer and the nations following
him were placed under a curse, and the earth itself was judged for their sin.
All of this happened before Genesis 1:2.

Not the Traditional View

Granted, this is not the traditional view of creation. Many may find it puzzling, perhaps
even disturbing. Most of us who have been raised in the church have accepted the first
two chapters of Genesis as a continuous, uninterrupted account of the origin of the
earth and man. After all, many may argue, doesn't the book of Genesis make it
perfectly clear that, in the beginning, God created the earth as a lifeless, shapeless,
chaotic mass? Isn't it apparent, from the second verse of chapter one, that floods
covered the earth while God's Spirit hovered over what would become a beautiful new
planet? Doesn't Scripture plainly record the six days of creation and all that was
involved in forming the earth during that first week?

Before answering any of these questions, it must be made clear that nothing will be
presented in this book that is out of harmony with God's Word. Every argument will be
backed up by biblical evidence, and no new ideas will be submitted without the support
of at least two or three clear scriptural references. With that in mind, let's take a look at
what the Scriptures have to say about the earth's origins.

The Clash With Science

It is generally acknowledged, based on chronologies found in the Old Testament, that
Adam was created about 6,000 years ago, or about 4,000 B.C. Since Darwin published
On the Origin of Species in the mid-1800's, those who have held to a literal
interpretation of the Bible have struggled to counter the claims of science for a creation

15

The Pre-Adamic Flood & Resources Supporting the Gap Theory

date stretching billions of years into the past. Most of the scientific evidence
accumulated during the past century has supported these claims of an old earth. Some
argue that scientists are basing their findings on previously-held assumptions relating
to the earth's antiquity, that they are merely seeing what they want to see. In other
words, they believe the evolutionary model which requires an earth millions, perhaps
billions of years old, and interpret any evidence they find based on those assumptions.
While there may be some merit to this, the fact remains that at best it is very difficult to
explain much of the scientific evidence accumulated during the past century in light of a
6,000-year-old earth.

Unfortunately, this leaves the Christian with a dilemma. On the one hand, science
claims the earth is billions of years old. On the other hand, biblical chronologies
suggest that the earth is only about 6,000 years old. Faced with this tension between
science and faith, the believer has two alternatives. One must either accept the
scientific evidence and view the biblical creation account as mythology, or be forced to
hold fast to a literal interpretation of the Scriptures and reject what science has to offer.
Neither of these alternatives are acceptable. The first violates basic exegetical
principles. Nowhere in Scripture are we led to believe that either the recorded
chronologies or the creation account are myths or allegories. Both the context and the
language itself point to a literal interpretation. In fact, New Testament writers, inspired
by the Holy Spirit, viewed the creation account as a literal event which took place at a
specific point in history.

The second alternative requires the believer to "stick his head in the sand" and ignore
the accumulated scientific evidence pointing to an old earth. As the weight of the
evidence grows, the Christian must close his eyes all the more tightly to keep his faith
intact. Not only is this unacceptable, it is unnecessary, as we'll soon see. Maybe you
haven't thought deeply about the subject because you were afraid that to do so might
shake the foundation upon which your faith is built. Perhaps you've already been
challenged in this area as a Christian in a secular society. If you're a parent, you may
have been forced to wrestle with these issues as your children grapple with the
evolutionary model being taught in our public schools.

Challenging the Common Assumption

Whether one accepts the scientific evidence or holds to a literal interpretation of the
Bible, there is one point on which both camps agree: the Scriptures, literally
interpreted, point to a creation date 6,000 years ago. This assumption is taken for
granted in the debate between the two sides. It's accepted without question.

We don't agree. The entire premise of this book is that you can take the Genesis
account very literally and not have any difficulty reconciling faith and science. We're
going to challenge assumptions that both believers and nonbelievers have made for
years. This isn't a two-sided issue, although that's traditionally the way it has been
presented. Those who have sought answers to the question of the earth's origins have
been puzzled by the apparent contradictions. There's a reason for that--a piece of the
puzzle has been missing. Well, perhaps "misplaced" is a better word. You see, it's
been there all along but we haven't known where to find it. The piece fits between
Genesis 1:1 and 1:2 and we're going to take a look at it in the following chapters.

16

The Pre-Adamic Flood & Resources Supporting the Gap Theory

Appendix Two

Did God Create a DEVIL?

by Herbert W. Armstrong
1958

Is THERE a devil? Many people talk about the devil and Satan. Others scoff and say
it's just superstition and imagination.

But is there a devil? According to most Christians the Bible is supposed to each that
the devil is the god of this world. Indeed it does teach that!

The Bible pictures the whole world under the sway of an invisible devil. Where did he
come from? Did God create a devil to tempt us and to try to lead us astray? And then
to punish us if we follow the devil?

God Is CREATOR of ALL!

So, let's look back to the very beginning. Open your Bible to Genesis 1:1. "In the
beginning God." God was before all. The next word is "created." "God created." He
created the heaven and the earth.

But the very next verse says this: "The earth was without form and void." The Hebrew
words for "without form and void" are tohu and bohu. Translated into English they
mean chaotic, in confusion, waste, and empty.

When God created the heaven and the earth, did He create this earth originally in a
state of confusion? Did He create it all topsy-turvy and chaotic?

World NOT Created in Chaos

We read in I Corinthians 14:33 that God is NOT the author of confusion. God is the
author of peace. God is the author of order and of law.

Notice Job 38:4-9. God says there that the angels shouted for joy when He created the
earth. It must then have been a perfect creation, not a creation that was in chaos and
confusion!

Why would He create it in disorder and then have to straighten it out? That doesn't
make sense! Dr. Bullinger, the Hebrew authority, says that the Hebrew word for
"created," used in Genesis 1:1, " implies that the creation was a perfect work." That
very word "created" implies a perfect and a beautiful order and system, not chaos or
confusion!

Then how did it become chaotic?

In Genesis 19:26, the same Hebrew word is used which is translated "was" in Gen. 1:2.
And there it is translated into the English word "became." In the first three chapters of
the Bible, and many other places where you find the word "was," in almost every case
it is denoting a condition that was different from a former condition. In other words, it
"BECAME" or "was made" that way. It had not always been that way.

17

The Pre-Adamic Flood & Resources Supporting the Gap Theory

The Earth BECAME Chaotic

Plainly the word "was" has the meaning of "became." The Rotherham translation of
Gen. 1:2, out of the original Hebrew language, is this: "Now the earth HAD BECOME
waste and empty." It hadn't always been that way.

In Jeremiah 4:23, in Isaiah 24:10, in Isaiah 34:11, and in other places in the Bible, you
find the same words, toha and boha, meaning chaotic and in confusion. In every case
that condition is a result of sin.

No Chaos Originally

Notice Isaiah 45:18. "Thus saith the Eternal that created the heavens, God himself that
formed the earth and made it, He hath established it, He created it not in vain." "In vain"
is an incorrect translation. In your Bible, if you have the marginal references, you will
find in the margin the proper translation "waste."

The original Hebrew word there is TOHU. This Hebrew word is the identical word used
in Gen. 1:2, meaning confusion, or emptiness. or waste - a result of disorder, a result of
violation of law. In Isaiah 45:18 we have the plain statement that God created the earth
not "toho," that is, not in confusion, not in disorder. But in Genesis 1:2, the earth was,
or the earth BECAME - as it ought to he translated -chaotic and in confusion!

Then it became that way after it was created. Now, what could have caused that
confusion? - that disorder? What sin could have wrecked the earth and brought it into
the condition in which it was found in Gen. 1:2?

Life Before Adam?

Now, what was the sin then that caused this physical destruction to the earth? It was
not a sin caused by humanity, because there had been no man on the earth until the
sixth day of that re-creation or that re-making. So it was not a sin of man. Adam was
the first man. We find over in I Corinthians 15:45 that Adam is called the first man on
this earth. In Genesis Eve is called the mother of all living human beings. There was no
other race prior to Adam and Eve.

So the sin which brought chaos was not caused by man. And yet life must have
populated the earth because a sin had occurred on the earth that brought it into a
condition of chaos and confusion by breaking the laws of God.

What kind of life could it have been? It wasn't human life. What was it that populated
this earth prior to the second verse of Genesis, the first chapter?

In Genesis 1:28, speaking to the man whom He had created, God said this: ''Be fruitful
and multiply and replenish the earth." What does that word replenish mean? To plenish
is to populate. To replenish means to repopulate -to populate all over again. Those
very words imply that the earth had been populated before!

Immediately after the flood in Genesis 9:1, God spoke to Noah. He blessed Noah and
his sons and said unto them: "Be fruitful and multiply and replenish the earth."
Identically the same words that He spoke to Adam!

18

The Pre-Adamic Flood & Resources Supporting the Gap Theory

In Noah's case we know He meant repopulate the earth. Then didn't He mean the
same thing when He used the identical words to Adam: "Be fruitful and multiply and
replenish the earth?" Certainly here is indication that the earth had been populated,
and that it was to be populated once again. Then what kind of life had populated the
earth prior to Adam, prior to the week called "creation week"?

Next, let's turn to II Peter 2:4: ''For if God spared not the angels that sinned.'' Here is
the sin of angels mentioned.

Sin of Angels!

Now read the next verse, "And spared not the old world," between Adam and Noah,
''but saved Noah the eighth person, a preacher of righteousness, bringing in the flood
upon the world of the ungodly." There it mentions the sins from Adam to Noah, and it
mentions the physical destruction to the earth as a result of the flood, a chaotic,
physical condition brought about on the earth by the sins of those men.

Was there a chaotic condition brought about on the earth as a result of the sins of
angles? The sin of the angels is mentioned first, and it occurred first! There was a devil
already there in existence by the time Adam was created. So the sin of the angels
happened before the creation of man.

Now read II Peter 2:6. ''Turning the cities of Sodom and Gomorrah into ashes, [God]
condemned them with an overthrow, making them an example to those that afterward
should live ungodly."

Universal sin was in those two Canaanite cities. Physical destruction came to the entire
part of the surface of the earth which those people occupied as a result of that sin.
Then didn't such a destruction come to the earth as a result of the sins of the angels
which occurred before Adam?

Now quickly turn over to Jude. In the sixth verse, you read this: "And the angels which
kept not their first estate, but left their own habitation [they had a place where they
lived, a habitation, an estate, and they left it], God hath reserved in everlasting chains
under darkness unto the judgment of the great day." Notice! It is the sinning angels
who are reserved in those chains under darkness, restrained from light, restrained from
truth until the judgment of the great day.

Angels Possess the Earth!

How plain! They had an estate which they didn't keep. In Hebrews 2:5 we read this:
''For unto the angels hath God not put in subjection the world to come of which we
speak." In other words, The World Tomorrow, the Kingdom of God, will not be under
subjection to angels. The present one is under subjection of fallen angels. The
demons, and the devil who is their head, rule this present earth and sway its
inhabitants. The Bible everywhere indicates and affirms that very fact.

How did they obtain their dominion? How did they acquire their power? How did they
maintain their control? Where did the devil get the power to control and to lead and to
rule this world?

The devil is the leader of fallen angels, as you will find in a number of places ( John
12:31, John 14:30, John 16:11). In II Cor. 4:4 the devil is called the god of this world.

19

The Pre-Adamic Flood & Resources Supporting the Gap Theory

He is the king or the prince of the evil world that we live in today. Let's see something
about the origin of the devil.

Turn to Isaiah 14, beginning with verse 4, "'Thou shalt take up this proverb against the
king of Babylon, and say, 'How hath the oppressor ceased the golden city ceased!'"

Here is a king of Babylon.

This account continues to tell how he had disrupted the earth. He was an invader, a
conqueror. He was a war monger, trying to take away from others and trying to acquire
all he could. He had just the opposite philosophy from that of God. In other words, he
had the philosophy of the devil. He represented. the devil. The king of Babylon was the
devil's instrument and tool.

Now we find in verse 12 that this lesser human type lifts to the great anti-type -the
devil - whom he represented and whose tool and instrument he was.

Rebellion of Lucifer

Things are said about the great former cherub, the devil, that could not be said about a
human being. God says, "How art thou fallen from heaven, O Lucifer." Lucifer means
shining one, or shining star of the dawn. God names things or people, or beings what
they are. Lucifer was originally a shining "star." Stars represent angels (Rev. 1:20). He
was a great cherub whose duties were represented by the bright morning star. He was
a light bringer. In other words, one who had great knowledge and truth and light, and
who was to give it to those who were placed under him. He was placed in a certain rule
and authority over angels.

Continuing in Isaiah 14: "How art thou cut down to the ground which didst weaken the
nations! For thou hast said in thine heart, 'I will ascend into heaven.'" Then he must
have been BELOW heaven. He must have been ON THE EARTH.

He said, "I will ascend into heaven, I will exalt my throne above the stars (that is, the
angels] of God." I want you to notice he had a throne, but he wasn't willing to be
content with his jurisdiction. He was out to rule the universe.

Now notice what else Lucifer said: "I will ascend above the heights of the CLOUDS. I
will be like the most High." "I'm going to be god myself," he said.

Lucifer Becomes the Devil

So Lucifer became the devil. God changed his name when his character changed. He
tried to make himself God. But we find HE WAS CAST DOWN TO THIS EARTH.

Now, quickly turn over to Ezekiel 28, verse 1. "Son of man, say unto the prince of
Tyrus. . ." The prince of Tyre, or Tyrus, was a very evil man. He was an aggressor, an
invader, a conqueror. He was a tool of the devil. Now, as we come to the twelfth verse,
just as in Isaiah 14, the lesser type lifts up to the great anti-type. We find the devil
himself pictured! Now we find one that is not human at all. For a few verses, it is talking
about the devil himself, and not about a human being.

Beginning at verse 12: ''Son of man, take up a lamentation upon the king of Tyrus."
Here is the REAL king that ruled in and through the prince of Tyrus. "And say unto him,
Thus saith the Lord God. Thou sealest up the sum, full of wisdom, and perfect in

20

The Pre-Adamic Flood & Resources Supporting the Gap Theory

beauty." Here was one who sealed up the sum total of perfection, of wisdom, and
beauty.

Could that be said about a man? Does God speak like that of any mortal man? Never!
He is speaking of some being far greater than man. Notice, "Thou hast been in Eden,
the garden of God." On the earth! Then he said, "The workmanship of thy tabrets and
thy pipes was prepared in thee in the day that thou wast CREATED." This was not a
human being, who was born.

The prophet continues to say, "Thou art the anointed CHERUB that covereth." If you
will refer to Exodus 25, verses 16-22, you will find the type of the throne of God
described. Included in the earthly type - the tabernacle in the days of Moses - was the
mercy seat which was a picture of the very throne of God. On it two cherubim were
placed. They were made of metals, of course, but their wings stretched out and
covered the very throne of God. They symbolized the two great cherubs whose wings
cover the very throne of God.

Through Ezekiel, God says: "Thou art the anointed cherub that covereth." In other
words, one of the two great cherubs ruling over millions of other angels! He was a
created being. He sealed up the sum total of perfection, of wisdom, and of beauty.
Then in verse 14, we read this: "I have set thee so," God said. God had set him in
office. "Thou wast upon the holy mountain of God,'' -Palestine or Eden! "Thou wast
perfect in thy ways from the day thou wast created. Here was a being that was created
perfect UNTIL INIQUITY WAS FOUND IN HIM.

That iniquity was described in Isaiah 14. He said, "I'm not satisfied with what I have. I'm
going to become an invader. I'm going to take God's place and be the God of the
universe." That was the devil's sin - INSUBORDINATION.

How the Earth Became Chaotic

A third of the angels united with Satan in the rebellion. That is what caused the chaos
of this earth. The sin of angels reached into the heavens and brought chaos on earth.
What the geologists and astronomers see is not an evolving universe, but the
wreckage of a titanic battle waged by spirits throughout space - a battle fought before
man's creation.

The earth was created perfect and complete. Then it BECAME chaotic as a result of
rebellion. And in six days, God re-made the earth, re-shaped, re-fashioned it, and
created human beings upon it.

He gave Adam a chance to take the place of Satan the devil. Remember, Lucifer had
been placed in rulership. God placed the great cherub, Lucifer, to carry out His
government on the earth; but Lucifer refused to carry out God's will, God's commands,
God's government. He wanted to substitute his own -So he disqualified himself.

Adam had the chance to supplant him. In the contest to see if Adam would conquer, if
he would obey God, he failed. He obeyed the devil instead, and man became the
property of the devil, and the whole human race was sold down the river to the devil
ever since.

Jesus Christ came 4000 years later and He entered the great contest - the contest of
the temptation on the Mount. He REFUSED to obey the devil. He quoted scripture

21

The Pre-Adamic Flood & Resources Supporting the Gap Theory

correctly. He obeyed God. Finally, He turned to the devil, and He gave Satan a
command. He said, "Get away from me," and the devil obeyed!

From that time on, the successor of Satan has been qualified to take over the rule of
the earth. But Jesus went to heaven for 1900 years. He is soon coming again, and
when He does, the devil will be DISPLACED. Christ will rule the earth; God's laws will
be restored. Order and peace will come at last!

So God did NOT create a devil. He created a cherub, Lucifer - perfect in his ways, but
with the power of free choice - and Lucifer transformed himself into a devil by rebellion
against the government of God!

Today, you face the question: Will You obey the ways of Satan, or the LAWS of GOD?

22

The Pre-Adamic Flood & Resources Supporting the Gap Theory

Appendix Three

Armstrong Gap Theory

From http://www.bibarch.com/

Perhaps the most ardent 20th century spokesmen of the gap theory were televangelist
Herbert W. Armstrong (1892-1986) and his son Garner Ted Armstrong. Challenged in
1924 by Hertha Dillon, a sister-in-law as Hertha's husband Walter Dillon was the
brother of Armstrong's wife Loma, Herbert W. Armstrong undertook a study of the
biblical account of creation and Darwinism (Armstrong 1986:293 see also Armstrong
1985:19-21 and Armstrong 1978:57-58).

Armstrong found the Scofield account compelling and incorporated it as part of his own
teachings and ultimately the theory became part of "the truth" taught on The World
Tomorrow radio and television programs and in The Plain Truth. The program had
millions of listeners and viewers for about 35 years (1950-1985). Garner Ted
Armstrong left The World Tomorrow telecast in 1978 and presently heads the Garner
Ted Armstrong Evangelistic Association.

The Ambassador College Bible Correspondence Course, Lesson 11, from 1956,
explained how a perfect pre-Adamic Earth became a ruin due to Satan's rebellion
against God (Armstrong and Meredith 1956:3-4). See also In the Beginning --Answers
to Questions from Genesis (Worldwide Church of God 1980:2-4).

In his Mystery of the Ages Armstrong explained:

From verse 2 of Genesis 1 on, the remainder of this first chapter of
the Bible is not describing the original creation of the earth. But it is
describing a renewing of the face of the earth, after it had become
waste and empty as a result of the sin of the angels.

What is described from verse 2 on, in the supposed creation chapter
of the Bible, did occur, according to the Bible, approximately 6,000
years ago. But that could have been millions or trillions of years after
the actual creation of the earth described in verse 1! (Armstrong
1985:75.)

His radio and television ministry popularized the theory. Ronald L. Numbers, who
apparently did not take the time to actually study the teachings of Armstrong and his
son Garner Ted but rather relied on secondary sources, states:

Like some gap theorists, Armstrong and his followers allowed for the
existence of an ancient earth, populated by Satan and his fallen
angels. Although they at times relied heavily on the writings of creation
scientists, the Armstrong people defended creationism primarily on
biblical grounds, refusing to dilute "Biblical truth to satisfy scientists by
equating it with scientific theory." (Numbers 1992:317.)

The Armstrongs, nevertheless, were outspoken proponents of the gap theory. They
argued vigorously against the notion that the creation of the universe and earth
occurred about 4,000 BCE and often wrote about it in The Plain Truth magazine and
discussed it on The World Tomorrow radio and television programs. As the Armstrongs

23

The Pre-Adamic Flood & Resources Supporting the Gap Theory

understood the Noachian deluge to have been a literal worldwide flood one could argue
that they did have a little common ground with creation scientists but in reality about
the only similarity was that both groups had their centers of operations in southern
California. Any other similarity was coincidental. Most Ambassador faculty and students
of that time regarded creation scientists as half-educated kooks which remains an
opinion shared to this day by most biblical archaeologists.

When Garner Ted Armstrong taught the second year Bible course, Theology 201 called
systematic theology, at Ambassador College in the 1960s he used After its Kind,
Before Abraham, and The Deluge Story in Stone by Bryon C. Nelson and later The
Genesis Flood by Whitcomb and Morris as textbooks. Garner Ted Armstrong's
teaching style, however, was to dissect a text and to expose the misassumptions and
biases of its authors. He went to considerable length to show the fallacies and
shortcomings of classical Darwinism, which he referred to as evolution, and to expound
the gap theory. Late in the decade the Worldwide Church of God published a well-
written, widely circulated anti-evolutionary booklet entitled A Theory for the Birds.

Another exposition of the gap theory appeared in Basil Wolverton's The Bible Story
(Wolverton 1982:3-10) published by the Worldwide Church of God. The material had
appeared earlier in The Plain Truth. Wolverton explained the consequences of Lucifer's
rebellion:

During the great battle when Satan and his demons tried to conquer
God, an awesome change came over the Earth. (Gen. 1:2) What had
long been a beautiful planet had been turned into a cosmic wreck
because Lucifer rebelled against his maker. The atmosphere was filled
with smoke and poison gases so thick that nothing could live in it.

The raging elements pounded the Earth. Little or no physical life
could survive through that terrible time. (Ps. 104:29.)

The only living beings left on the planet were the evil, restless
demons whose lawbreaking had broken the perfect balance, harmony
and beauty of a world God had lovingly created for His creatures.

For a time our world stayed buried in a deep blanket of gases,
smoke and water. Oceans covered the whole Earth. There was no
longer any dry land. The atmosphere was so clogged with clouds of
tiny bits of matter that no light could reach the seas. We don't know
how long this condition lasted, but later came the time when God
started preparing for a very important event in His great plan. That was
the bringing of human beings into existence. (Wolverton 1982:5-6.)

Since the death of Herbert W. Armstrong the Worldwide Church of God moved to a
relatively moderate, middle of the road evangelical stance in these matters. Its leaders
redirected the attention of the church's membership to other fundamental biblical
doctrinal matters, reconciliatory ministry, and practical Christian living issues and do
not make sensational evangelistic claims out of the Genesis accounts of creation and
the Noachian flood.

In the early 1990s articles appearing in The Plain Truth by John Halford entitled
"Religion and Science: Bridging the Gap" and "Evolution: Fact or Faith?" admitted
microevolution and called for a new analysis of Genesis 1 more in line with scientific
evidence but rejected macroevolutionary theory. In a supplement to The Plain Truth
entitled Must We Choose Between Science and the Bible? its writer asked "Do we
have to choose between divine creation and evolution? The fact is, we need not find an

24

The Pre-Adamic Flood & Resources Supporting the Gap Theory

insoluble conflict between living faith and scientific evidence" (Worldwide Church of
God 1994:1). In 1996 the Worldwide Church of God published their Creation or
Evolution booklet concluding "there need be no final conflict between science and
religion" (Worldwide Church of God 1999:69). In the final decade of the 20th century
the Worldwide Church of God carefully distanced itself from the gap theory.

More recently, the magazine's cover story was "Science and Religion: Must we
Choose?" consisting of a set of three thought-provoking articles: "The Real Question Is
Who" by Monte Wolverton (son of Basil Wolverton), "Will We Ever Get Our Act
Together?" by Neil Earle, and "The Creation Date Controversy" by Hugh Ross
(president of the Pasadena-based Reasons to Believe ministry). The implication of the
article triad is that the Plain Truth Ministries and the Worldwide Church of God have
moved toward the reconciliation of religion and science. This is consistent with the
reconciliatory thrust of both organizations.

Nevertheless, the gap theory continues to be taught by some of the derivative groups
spinning off from the Worldwide Church of God such as the United Church of God
publisher of The Good News and the Living Church of God publisher of Tomorrow's
World. Herbert W. Armstrong's son Garner Ted Armstrong (see Garner Ted Armstrong
Evangelistic Association), a committed anti-evolutionist, continued to teach and preach
the gap theory and lead the Intercontinental Church of God. Authors from these groups
such as United Church of God writers John Ross Schroeder and Mario Seiglie develop
some compelling arguments for the theory and present them clearly and thoroughly
(see Creation or Evolution — Does It Really Matter What You Believe?).

According to Numbers:

During the second half of the twentieth century, few denominations
promoted strict creationism more vigorously than the apocalyptic
Jehovah's Witnesses and the Worldwide Church of God, members of
the same millenarian family that included the Seventh-day Adventists.
The Witnesses sprang indirectly from the Advent Christian Church,
which, like the Seventh-day Adventists, had grown out of the ashes of
the Millerite movement of the 1840s. The Worldwide Church of God
(formerly the Radio Church of God) was a third-generation offshoot of
the Seventh-day Adventists by way of the Church of God (Seventh
Day). Both sects, though often indebted to the scientific creationists for
arguments and evidence, remained ambivalent toward flood geology
and antagonistic toward its promoters, a feeling amply reciprocated.
Duane T. Gish summed up the common attitude: "Of course, they don't
want anything to do with us, and we don't want anything to do with
them". (Numbers 1992:316.)

Numbers attributes the rise of the Church of God (Seventh Day) and therefore the
Worldwide Church of God to the Millerite movement and the Seventh-day Adventist
Church. This is a common misconception and over-simplification. The history of the
Church of God (Seventh Day) in the New World precedes the Adventist and Millerite
movements by nearly two centuries. Many Millerites, upon discovering the Sabbath,
joined themselves to Sabbath-observing Church of God congregations. Later some of
these individuals attempted to wholly subvert the underlying doctrines and the core
values of the Church of God and basically they swamped it with Millerites. When Mrs.
White declared herself a prophetess and proceeded to preach heresy those Church of
God people who did not get caught up in the advent movement absented themselves
from the Adventists and attempted to rebuild their own Church of God. This period of
terrible turmoil lasted about twenty years.

25

The Pre-Adamic Flood & Resources Supporting the Gap Theory

With the end of the World Tomorrow program, basically its single mass media
proponent, the theory began to decline. Scientific creationism became increasing
militant and fiercely argued against it. Nevertheless, it has enjoyed some resurgence
with the republishing of the Scofield Study Bible and the Dake Bible.

26

The Pre-Adamic Flood & Resources Supporting the Gap Theory

Appendix Four

Questions and Answers

Answers to readers' questions.

From http://www.gnmagazine.org/issues/gn65/questionsanswers65.htm

From the July-August 2006 Good News magazine, p. 29

Question: How does the evidence of life on earth millions of years ago equate
with the Bible claim that God created life on earth recently by comparison?

—N.J., Redruth, England

Answer: Could some forms of life, such as the dinosaurs, have been present in a
world unfit for human habitation before the seven-day creation account in Genesis 1? If
we carefully examine the first two verses in the Bible, we might be surprised at the
possible conclusion.

We are introduced to the account of the creation of the earth in Genesis 1:1-2: "In the
beginning God created the heavens and the earth. The earth was without form, and
void; and darkness was on the face of the deep."

The original Hebrew wording, compared with other passages of Scripture, has led
some to conclude that a considerable time interval is indicated between these two
verses. If such an interval is indeed intended, there is no discrepancy between the
Bible record and scientific discoveries that indicate that the earth could be much older
than a few thousand years. If, on the other hand, there is no such gap, then the earth
itself must be only around 6,000 years old—which most scientists consider an
impossibility.

Do other passages, as well as history, shed any light on this question?

Some scholars propose that Genesis 1:2 can or should be translated: "Now the earth
became without form, and void .. ." as opposed to the common rendering "The earth
was without form, and void . . ." Others dismiss this idea entirely. They assume the
original Hebrew word hayah must be translated "was" and then assume the earth was
originally created in this disorderly condition.

However, as can be seen from many Bible helps, both translations of the word hayah
are possible. Only the context can determine which is correct.

Gleason Archer, professor of biblical languages, comments: "It should be noted in this
connection that the verb was in Genesis 1:2 may quite possibly be rendered 'became'
and be construed to mean: 'And the earth became formless and void.' Only a cosmic
catastrophe could account for the introduction of chaotic confusion into the original
perfection of God's creation. This interpretation certainly seems to be exegetically
tenable" (A Survey of Old Testament Introduction, 1974, p. 184).

In a footnote Archer adds: "Properly speaking, this verb hayah never has the meaning
of static being like the copular verb 'to be.' Its basic notion is that of becoming or
emerging as such and such, or of coming into being . . . Sometimes a distinction is
attempted along the following lines: hayah means 'become' only when it is followed by
the preposition le; otherwise there is no explicit idea of becoming.

27

The Pre-Adamic Flood & Resources Supporting the Gap Theory

"But this distinction will not stand up under analysis. In Gen[esis] 3:20 the proper
rendering is: 'And Adam called the name of his wife Eve, because she became the
mother of all living.' No le follows the verb in this case. So also in Gen[esis] 4:20: 'Jabal
became the father of tent dwellers.' Therefore there can be no grammatical objection
raised to translating Gen[esis] 1:2: 'And the earth became a wasteness and
desolation.'"

Some scholars also argue against translating hayah "became" instead of "was" in
Genesis 1:2 because they assume this interpretation came about only recently, after
geology revealed the strata of the earth to be very old. Thus, they consider this
explanation a desperate attempt to reconcile the Genesis account with modern
geology.

The explanation that there existed an indefinite period between the initial beautiful
creation described in Genesis 1:1 and the earth becoming waste and void in verse 2
has been called, sometimes disparagingly, "the gap theory." The idea was attributed to
scholars Thomas Chalmers in the 19th century and to Cyrus Scofield in the 20th.

Yet the interpretation that the earth "became" waste and void has been discussed for
close to 2,000 years. The earliest known recorded controversy on this point can be
attributed to Jewish sages at the beginning of the second century.

The Hebrew scholars who wrote the Targum of Onkelos, the earliest of the Aramaic
versions of the Old Testament, translated Genesis 1:2 as "and the earth was laid
waste." The original language led them to understand that something had occurred that
had "laid waste" the earth, and they interpreted this as a destruction.

The early Catholic theologian Origen (186-254), in his commentary De Principiis,
explains regarding Genesis 1:2 that the original earth had been "cast downwards"
(Ante-Nicene Fathers, 1917, p. 342).

In the Middle Ages the Flemish scholar Hugo St. Victor (1097-1141) wrote about
Genesis 1:2: "Perhaps enough has already been debated about these matters thus far,
if we add only this: 'How long did the world remain in this disorder before the regular reordering
. . . of it was taken in hand?'" (De Sacramentis Christianae Fidei, Book 1, Part
1, Chapter 6). Other medieval scholars, such as Dionysius Peavius and Pererius, also
considered that there was an interval between Genesis 1:1 and 1:2.

According to The New Schaff-Herzog Encyclopedia of Religious Knowledge, the Dutch
scholar Simon Episcopius (1583-1643) taught that the earth had originally been
created before the six days of creation described in Genesis (1952, Vol. 3, p. 302). This
was roughly 200 years before geologists determined the earth to be far older than
6,000 years.

These numerous examples show us that the idea of an interval between Genesis 1:1
and 1:2 has a long history. Any claim that it is of only recent origin—that it was invented
simply as a desperate attempt to reconcile the Genesis account with geology—is
groundless.

Perhaps the best treatment on both sides of this question is given by the late Arthur
Custance in his book Without Form and Void: A Study of the Meaning of Genesis

1:2. Dr. Custance states, "To me, this issue is important, and after studying the
problem for some thirty years and after reading everything I could lay my hands on pro
28

The Pre-Adamic Flood & Resources Supporting the Gap Theory

and con and after accumulating in my own library some 300 commentaries on Genesis,
the earliest being dated 1670, I am persuaded that there is, on the basis of the
evidence, far more reason to translate Gen. 1:2 as 'But the earth had become a ruin
and a desolation, etc.' than there is for any of the conventional translations in our
modern versions" (1970, p.7).

For further understanding of this issue, please request or download our free booklet
Creation or Evolution: Does It Really Matter What You Believe? The sidebar on
pages 30 and 31, "Genesis 1 and the Days of Creation," sheds more light on this
question. GN

29

The Pre-Adamic Flood & Resources Supporting the Gap Theory

Appendix Five

Inner Earth May Hold More Water Than the Seas

Japanese scientists say their experiments show there may be as much as
five times more water in Earth's deep mantle than on the surface
By Ben Harder
for National Geographic News
March 7, 2002

http://news.nationalgeographic.com/news/2002/03/0307_0307_waterworld.html

[NOTE: when I somehow stumbled across this article several years ago, I felt it imperative to
send it on to various Creation Science organisations. Presumably they have looked into it and
come to scientific conclusions – I haven’t heard. For me it seems to answer the question ‘what
were the ‘fountains of the deep’ mentioned in Gen. 7:11?’:

"In the six hundredth year of Noah's life, in the second month, the seventeenth day of the
month, the same day were all the fountains of the great deep broken up, and the windows of
heaven were opened."]

Molten rocks deep in the earths interior may be surprisingly wet, Japanese researchers
say. From lab experiments, they have concluded there may be more H2O deep
underground than in all oceans, lakes, and rivers combined.

The scientists first heated "mineral cocktails" to a white-hot 1600 degrees Celsius
(2900 degrees Fahrenheit) and squeezed them until the pressure reached more than
three million pounds per square inch (200,000 kilograms per square centimeter). Then
they cooked the samples for an hour.
The experiments replicated the environment and conditions deep in the Earth.

Based on what they witnessed in their lab, the researchers concluded that more water
probably exists deep within the Earth than is present on Earth's surface—as much as
five times more.

"Our results suggest that the lower mantle can potentially store considerable amounts
of water," said Motohiko Murakami of the Tokyo Institute of Technology, where the
experiments were conducted.

"The presence of water in the crystal structure of [deep-Earth] minerals would be
expected to soften the minerals and change their flow behavior," he added. That, in
turn, could affect how the innards of the planet mix and shift over time, and could
indirectly affect conditions and forces near the surface, such as plate tectonics.

Wet Rocks

Far beneath the seas, in the lower mantle, rocks exist at temperatures and pressures
similar to those recreated in the Tokyo lab. The research team wanted to determine
how much water might be in that region of Earth's interior, which they did by studying
the nature of the chemical reactions in their tabletop mini-mantle.

The results indicated that the lower mantle has a lot of water, they reported March 8 in
the journal Science.

30

The Pre-Adamic Flood & Resources Supporting the Gap Theory

Murakami and his colleagues reached their conclusion based on how much water they
managed to dissolve under the experiment's extreme conditions in several types of
material that make up much of the lower mantle.

They used heat and pressure—25.5 gigapascals of it, or more than 250,000 times
natural atmospheric pressure at sea level—to create four mineral compounds that exist
in the lower mantle.

These minerals—manganese perovskite, calcium perovskite, magnesiowustite, and
stishovite—were produced as a result of the reactions among the chemical ingredients
the researchers had placed inside a pressurizing multi-anvil apparatus. When water
was added, some of it was absorbed into the newly formed minerals.

In different trials, the scientists slightly varied the proportions of the ingredients they
used, and added or removed trace quantities of certain metallic compounds that they
suspect mix in small amounts with more abundant materials in the lower mantle.

The trials resulted in different amounts of water being absorbed into the mantle-like
matter. But in each case, water made up at least 0.19 percent of the material's mass.

That doesn't sound like a lot, but for Murakami and his team, the finding was a
watershed.

A Waveless Waterworld

Earth's oceans make up just 0.02 percent of the planet's total mass. This means the
vast lower mantle could contain many times more water than floats on the planet's
surface.

The Japanese experiments don't guarantee that that's the case, of course, because the
researchers haven't actually measured the mantle. No one is ever likely to get a direct
sample of material from the fiery mantle itself. But by simulating mantle-like conditions
in the lab, Murakami and his colleagues have demonstrated that a water-rich inner
Earth is plausible.

Just how water-rich it is depends on the amount of trace "impurities" in the minerals.
Compounds such as aluminum and iron "could dramatically change the solubility of
water in these minerals," Murakami explained.

Other research has suggested that a zone between the mantle and the crust also
contain a great deal of water, the Japanese researchers noted. If so, there could be
more than ten times the amount of water inside the planet as there is on its surface.

31

On sexual attraction

2010-09-02T20:51:00.000-07:00

This blog is not specially about sexual orientation, but I have found an article about fruit flies who showed a biological tendency towards homosexuality but were not hard-wired that way and were able to be changed to a heterosexuality orientation. Homosexuality in the insect world could really upset the balance of the planet.

In fruit flies, homosexuality is biological but not hard-wired
December 9, 2007 While the biological basis for homosexuality remains a mystery, a team of neurobiologists reports they may have closed in on an answer -- by a nose.
The team led by University of Illinois at Chicago researcher David Featherstone has discovered that sexual orientation in fruit flies is controlled by a previously unknown regulator of synapse strength. Armed with this knowledge, the researchers found they were able to use either genetic manipulation or drugs to turn the flies' homosexual behavior on and off within hours.

Featherstone, associate professor of biological sciences at UIC, and his coworkers discovered a gene in fruit flies they called "genderblind," or GB. A mutation in GB turns flies bisexual.

Featherstone found the gene interesting initially because it has the unusual ability to transport the neurotransmitter glutamate out of glial cells -- cells that support and nourish nerve cells but do not fire like neurons do. Previous work from his laboratory showed that changing the amount of glutamate outside cells can change the strength of nerve cell junctions, or synapses, which play a key role in human and animal behavior.

But the GB gene became even more interesting when post-doctoral researcher Yael Grosjean noticed that all the GB mutant male flies were courting other males.

"It was very dramatic," said Featherstone. "The GB mutant males treated other males exactly the same way normal male flies would treat a female. They even attempted copulation."

Other genes that alter sexual orientation have been described, but most just control whether the brain develops as genetically male or female. It's still unknown why a male brain chooses to do male things and a female brain does female things. The discovery of GB provided an opportunity to understand why males choose to mate with females.

"Based on our previous work, we reasoned that GB mutants might show homosexual behavior because their glutamatergic synapses were altered in some way," said Featherstone. Specifically, the GB mutant synapses might be stronger.

"Homosexual courtship might be sort of an 'overreaction' to sexual stimuli," he explained.

To test this, he and his colleagues genetically altered synapse strength independent of GB, and also fed the flies drugs that can alter synapse strength. As predicted, they were able to turn fly homosexuality on and off -- and within hours.

"It was amazing. I never thought we'd be able to do that sort of thing, because sexual orientation is supposed to be hard-wired," he said. "This fundamentally changes how we think about this behavior."

Featherstone and his colleagues reasoned that adult fly brains have dual-track sensory circuits, one that triggers heterosexual behavior, the other homosexual. When GB suppresses glutamatergic synapses, the homosexual circuit is blocked.

Further work showed precisely how this happens -- without GB to suppress synapse strength, the flies no longer interpreted smells the same way.

"Pheromones are powerful sexual stimuli," Featherstone said. "As it turns out, the GB mutant flies were perceiving pheromones differently. Specifically, the GB mutant males were no longer recognizing male pheromones as a repulsive stimulus."

Featherstone says it may someday be possible to domesticate insects such as fruit flies and manipulate their sense of smell to turn them into useful pollinators rather than costly pests.

The research appeared online today in Nature Neuroscience, and is scheduled for print in the January issue.

Source: University of Illinois at Chicago

Evolutionists not happy with age of remains from creation-evolution.com

2010-08-05T00:06:00.000-07:00

Cave Date Puts Hominids Too Early 04/25/2003
Results are in from the dating game, says Science Magazine 04/25/03, but the contestants are not happy. Darryl Granger used a new dating method to estimate the age of remains in Sterkfontein Cave, South Africa, and concluded the hominid skeleton there is 4 million years old, nearly a million years older than the oldest previous estimate. Others don’t buy it. That puts australopithecines in south Africa far earlier than expected, and makes Little Foot (one of the skeletons) the contemporary of Lucy’s ancestor. Yet the skeleton “does not resemble” that ancestor in crucial aspects, complains one investigator. To add confusion, dates from recent discoveries in nearby Jahovec Cave may represent two types of australopithecines, “suggesting a diversity of 4-million-year-old hominids.” Critics feel use of the cosmic radionuclide dating method is on “shaky ground” because of the complexities of the cave environment.
A news report on the story can be found at Purdue News.
So the hominid wars carry on. As usual, shaky method + shaky assumptions = shaky story. If contemporaneous australopithecines showed significant diversity, on what basis can scientists arrange them into an evolutionary relationship? See also Tim White’s damaging assessment of assumptions used in interpreting hominid bones in our March 28 edition

Comparing Spiders and Cave Art from Creation Evolution Headlines

2010-08-04T23:58:00.001-07:00

Spiders and Cavemen Puzzle Evolutionists With Their Art 07/26/2001
The August 2001 issue of National Geographic is out, and contains two honest admissions of puzzlement for evolutionists. In an article on spider webs, biologist Bill Eberhard ponders how evolution could have endowed the lowly spider with these skills:
You have an essentially blind animal with a limited nervous system building a complicated structure in an unpredictable environment. The spider makes what for a human would be very complex calculations: ‘How big is the open space? How much silk do I have? What attachment points are available?’ Spiders are not little automatons making the same thing over and over. They’re flexible. And they’re not stupidly flexible; they’re smart flexible.
The article describes how most spiders have three pairs of spinnerets, each with with hundreds of silk-producing spigots controlled by muscles. Spider silk is more elastic than nylon and stronger than steel.
In an unrelated article, the magazine comments on the artistic skill of prehistoric art found recently in a cave in France, alleged to be 35,000 years old. “Art this old was supposed to be crude and stiff, but there is nothing primitive about Chauvet.” The published pictures reveal the “subtle shading, ingenious use of perspective, and elegant lines of Chauvet’s masterworks” that stunned its discoverers in 1994. “For decades scholars had theorized that art had advanced in slow stages from primitive scratchings to lively, naturalistic renderings . . . . Then carbon dates came in, and prehistorians reeled. Approximately twice as old as those in the more famous caves [such as Lascoux], Chauvet’s images represented not the culmination of prehistoric art but its earliest known beginnings. A few thousand years after anatomically modern humans appeared in Europe, cave painting was as sophisticated as it would ever be.”
Here you have two anomalies for evolution to explain: lowly spiders with skill unmatched by humans, building all sorts of clever insect nets that look like works of art, to say nothing of the problem of how they invented a substance more flexible and strong than Kevlar. Then on a totally different front, you find the earliest human art to be the best! Compare these Chauvet paintings with the crude petroglyphs and cowboyglyphs of the southwest, and you do not find evolution, you find degeneration. If we just keep reporting stories like this, maybe some skeptical readers will just let the evidence itself gradually convince them that something is drastically wrong with the evolutionary view of the world.

From Creation Evolution Headlines about age of Chauvet Cave

2010-08-04T23:54:00.001-07:00

Age of Chauvet Cave Art Disputed 04/22/2003
A debate is rising over the claim France’s cave art in Chauvet is 30,000 years old, says New Scientist. Some critics think the radiocarbon date is unreliable since it was done at one lab. They also imagine it hard to believe that the best cave art was 15,000 years earlier than thought; the earliest art should have been more primitive and improved as early man evolved. Chauvet cave was discovered in 1994. When the paintings were dated by the Carbon-14 method, the results “shocked everyone.”
Let this be a lesson in the unreliability of dating methods and in the implausibility of evolutionary assumptions about the rise of man. See also our July 2001 and Oct 2001 about Chauvet Cave. What about the Italian cave art National Geographic reported November 2001 that was claimed to be 35,000 years old and just as good?

What evolutionists said about extinction 10,000 years ago

2010-07-05T18:36:00.000-07:00

The Gap theory teaches that God destroyed the previous worlds. This fossil evidence below says it was about 10,000 years ago. Those who do not believe in the Creator are still searching for human answers.

Extinction of Woolly Mammoth, Saber-Toothed Cat May Have Been Caused by Human Predator

ScienceDaily (July 1, 2010) — A new analysis of the extinction of woolly mammoths and other large mammals more than 10,000 years ago suggests that they may have fallen victim to the same type of "trophic cascade" of ecosystem disruption that scientists say is being caused today by the global decline of predators such as wolves, cougars, and sharks.

In each case the cascading events were originally begun by human disruption of ecosystems, a new study concludes, but around 15,000 years ago the problem was not the loss of a key predator, but the addition of one -- human hunters with spears.

In a study published in the journal BioScience, researchers propose that this mass extinction was caused by newly-arrived humans tipping the balance of power and competing with major predators such as saber-toothed cats. An equilibrium that had survived for thousands of years was disrupted, possibly explaining the loss of two-thirds of North America's large mammals during this period.

"For decades, scientists have been debating the causes of this mass extinction, and the two theories with the most support are hunting pressures from the arrival of humans, and climate change," said William Ripple, a professor of forest ecosystems and society at Oregon State University, and an expert on the ecosystem alterations that scientists are increasingly finding when predators are added or removed.

"We believe humans indeed may have been a factor, but not as most current theory suggests, simply by hunting animals to extinction," Ripple said. "Rather, we think humans provided competition for other predators that still did the bulk of the killing. But we were the triggering mechanism that disrupted the ecosystem."

In the late Pleistocene, researchers say, major predators dominated North America in an uneasy stability with a wide range of mammals: mammoths, mastodons, ground sloths, camels, horses, and several species of bison. The new study cites previous evidence from carnivore tooth wear and fracture, growth rates of prey, and other factors that suggest that there were no serious shortages of food caused by environmental change 10,000 to 15,000 years ago.

Quite contrary to that, the large herbivores seemed to be growing quickly and just as quickly had their numbers reduced by a range of significant carnivorous predators, not the least of which was lions, dire wolves, and two species of saber-toothed cats. Food was plentiful for herbivores, the system was balanced, but it was dominated by predators.

"When human hunters arrived on the scene, they provided new competition with these carnivores for the same prey," said Blaire Van Valkenburgh, an expert at UCLA on the paleobiology of carnivores, and a co-author with Ripple on this study.

"The humans were also omnivores, and could live on plant foods if necessary," Van Valkenburgh said. "We think this may have triggered a sequential collapse not only in the large herbivores but ultimately their predators as well. Importantly, humans had some other defenses against predation, such as fire, weapons and living in groups, so they were able to survive."

But the driving force in eliminating the large mammals, according to the new theory, was not humans -- they just got the process started. After that, predators increasingly desperate for food may have driven their prey to extinction over long periods of time -- and then eventually died out themselves.

In recent studies in Yellowstone National Park and elsewhere, scientists from OSU and other institutions have explored these "trophic cascades," often caused by the loss or introduction of a single major predator in an ecosystem. With the elimination of wolves from Yellowstone, for instance, the numbers of elk exploded. This caused widespread overgrazing; damage to stream ecosystems; the slow demise of aspen forests; and ultimate effects on everything from trees to beaver, fish, birds, and other life forms. When wolves were re-introduced to Yellowstone, studies are showing that those processes have begun to reverse themselves.

"We think the evidence shows that major ecosystem disruptions, resulting in these domino effects, can be caused either by subtracting or adding a major predator," Ripple said. "In the case of the woolly mammoths and saber-toothed tiger, the problems may have begun by adding a predator, in this case humans."

The new analysis draws on many other existing studies in making its case.

For instance, other research describes this process with a model in modern times in Alaska. There, the allowance of relatively limited human hunting on moose caused wolves to switch some of their predation to sheep, ultimately resulting in a precipitous decline in populations not only of moose but also wolves and sheep.

The loss of species in North America during the late Pleistocene was remarkable -- about 80 percent of 51 large herbivore species went extinct, along with more than 60 percent of important large carnivores. Previous research has documented the growth rates of North American mammoths by studying their tusks, revealing no evidence of reduced growth caused by inadequate food -- thus offering no support for climate-induced habitat decline.

It seems that diverse and abundant carnivores kept herbivore numbers below levels where food becomes limiting. By contrast, the large population of predators such as dire wolves and saber tooth cats caused them to compete intensely for food, as evidenced by heavy tooth wear.

"Heavily worn and fractured teeth are a result of bone consumption, something most carnivores avoid unless prey is difficult to acquire," says Van Valkenburgh.

Trophic cascades initiated by humans are broadly demonstrated, the researchers report. In North America, it may have started with the arrival of the first humans, but continues today with the extirpation of wolves, cougars and other predators around the world. The hunting of whales in the last century may have led to predatory killer whales turning their attention to other prey such as seals and sea otters -- and the declines in sea otter populations has led to an explosion of sea urchins and collapse of kelp forest ecosystems.

"In the terrestrial realm, it is important that we have a better understanding of how Pleistocene ecosystems were structured as we proceed in maintaining and restoring today's ecosystems," the researchers wrote in their conclusion. "In the aquatic realm, the Earth's oceans are the last frontier for megafaunal species declines and extinctions."

"The tragic cascade of species declines due to human harvesting of marine megafauna happening now may be a repeat of the cascade that occurred with the onset of human harvesting of terrestrial megafauna more than 10,000 years ago. This is a sobering thought, but it is not too late to alter our course this time around in the interest of sustaining Earth's ecosystems."

--------------------------------------------------------------------------------

Story Source:

The above story is reprinted (with editorial adaptations by ScienceDaily staff) from materials provided by Oregon State University, via EurekAlert!, a service of AAAS.

--------------------------------------------------------------------------------

Journal Reference:

William J. Ripple and Blaire Van Valkenburgh

Incidents where God changed the speech of men

2010-07-04T14:15:00.000-07:00

Our Sunday School lesson was about the Coming of the Holy Spirit on Pentescost and how the believers were able to speak in other languages. I thought it would be interesting to compare the times the God changed the speech of men and what science says about the speech center.

A. The Tower of Babel-the people all had the same language but God instantly confused them so they could not understand each other.

Genesis 11 (New International Version)
The Tower of Babel
1 Now the whole world had one language and a common speech. 2 As men moved eastward, [a] they found a plain in Shinar [b] and settled there.
3 They said to each other, "Come, let's make bricks and bake them thoroughly." They used brick instead of stone, and tar for mortar. 4 Then they said, "Come, let us build ourselves a city, with a tower that reaches to the heavens, so that we may make a name for ourselves and not be scattered over the face of the whole earth."

5 But the LORD came down to see the city and the tower that the men were building. 6 The LORD said, "If as one people speaking the same language they have begun to do this, then nothing they plan to do will be impossible for them. 7 Come, let us go down and confuse their language so they will not understand each other."

8 So the LORD scattered them from there over all the earth, and they stopped building the city. 9 That is why it was called Babel [c] —because there the LORD confused the language of the whole world. From there the LORD scattered them over the face of the whole earth.

B. Moses says he cannot speak publicly and God says he is the Creator.He says also he makes people deaf or mute.

Exodus 4:9-12 (New International Version)
9 But if they do not believe these two signs or listen to you, take some water from the Nile and pour it on the dry ground. The water you take from the river will become blood on the ground."

10 Moses said to the LORD, "O Lord, I have never been eloquent, neither in the past nor since you have spoken to your servant. I am slow of speech and tongue."

11 The LORD said to him, "Who gave man his mouth? Who makes him deaf or mute? Who gives him sight or makes him blind? Is it not I, the LORD ? 12 Now go; I will help you speak and will teach you what to say."

C. Balaam's Donkey- an animal speaks to a man.

Numbers 22 (NIV)

21 Balaam got up in the morning, saddled his donkey and went with the princes of Moab. 22 But God was very angry when he went, and the angel of the LORD stood in the road to oppose him. Balaam was riding on his donkey, and his two servants were with him. 23 When the donkey saw the angel of the LORD standing in the road with a drawn sword in his hand, she turned off the road into a field. Balaam beat her to get her back on the road.
24 Then the angel of the LORD stood in a narrow path between two vineyards, with walls on both sides. 25 When the donkey saw the angel of the LORD, she pressed close to the wall, crushing Balaam's foot against it. So he beat her again.

26 Then the angel of the LORD moved on ahead and stood in a narrow place where there was no room to turn, either to the right or to the left. 27 When the donkey saw the angel of the LORD, she lay down under Balaam, and he was angry and beat her with his staff. 28 Then the LORD opened the donkey's mouth, and she said to Balaam, "What have I done to you to make you beat me these three times?"

29 Balaam answered the donkey, "You have made a fool of me! If I had a sword in my hand, I would kill you right now."

30 The donkey said to Balaam, "Am I not your own donkey, which you have always ridden, to this day? Have I been in the habit of doing this to you?"
"No," he said.

31 Then the LORD opened Balaam's eyes, and he saw the angel of the LORD standing in the road with his sword drawn. So he bowed low and fell facedown.

D. The believers at Pentescost speak languages they don't know.

Acts 2 (New International Version)
The Holy Spirit Comes at Pentecost
1When the day of Pentecost came, they were all together in one place. 2Suddenly a sound like the blowing of a violent wind came from heaven and filled the whole house where they were sitting. 3They saw what seemed to be tongues of fire that separated and came to rest on each of them. 4All of them were filled with the Holy Spirit and began to speak in other tongues[a] as the Spirit enabled them.
5Now there were staying in Jerusalem God-fearing Jews from every nation under heaven. 6When they heard this sound, a crowd came together in bewilderment, because each one heard them speaking in his own language. 7Utterly amazed, they asked: "Are not all these men who are speaking Galileans? 8Then how is it that each of us hears them in his own native language? 9Parthians, Medes and Elamites; residents of Mesopotamia, Judea and Cappadocia, Pontus and Asia, 10Phrygia and Pamphylia, Egypt and the parts of Libya near Cyrene; visitors from Rome 11 (both Jews and converts to Judaism); Cretans and Arabs-we hear them declaring the wonders of God in our own tongues!" 12Amazed and perplexed, they asked one another, "What does this mean?"

E. Biological data on speech center-evolutionary biologists are very interested in where the speech center is and have tried to locate it in
animals to see how it evolved. The speech center and the ability to understand language are different functions.

The speech center in our brain is most commonly known as the ‘Broca’s Area’. In right-handed people, the left hemisphere of the brain has the parietal lobe in it. The speech center lies in this parietal lobe. In most left-handed people also this lies in the left hemisphere but not in all. The Broca’s motor speech area is responsible for controlling the motor activities of all anatomic structures. It is named after a French Surgeon and Anatomist by name Pierre Paul Broca (1824-80). He carried out extensive studies about our brain. The movements of the lips, jaws and tongue is possible by the motor nerves. Pierre Paul Broca identified the Broca’s area in 1865 by autopsying brains. Most research was carried on with animals who never talk.

The center for the language recognition is situated in the right hemisphere. One who loses speech activities may be capable of understanding what is being spoken to him and vice versa. This condition is named as Aphasia. The person is capable of understanding speech (and writing in few cases) but unable to talk.

Damage to the speech centers results in the three speech disorders – Aphasia, Dysarthria and Dysphonia. Any weakness in the muscles responsible for the production of speech cause defect in the articulation and rhythm of speech. This is termed as Dysarthria. Amyotrophic lateral sclerosis (Lou Gehrig’s disease) and Myasthenia Gravis are two other diseases associated with muscle weakness defects. A brain tumor or some non-neurological factor may lead to hoarseness in the voice. This is called Dysphonia. Aphasia can be of two types – Motor Aphasia (inability to express thoughts, neither in speech or writing) and Sensory Aphasia (inability to understand speech nor read).

An infant is born with the ability to learn but not to speak. Speaking is inherent in all human species. The basic language of communication is passed to the children at a very young age. he learns speaking very easily from his surrounding, his family and peers. Since then he keeps adding to his list of vocabulary. The additions is due to the exposure to education and experience.

http://speechtherapy.ygoy.com/where-is-speech-center-in-brain/

3 Articles from Answers in Genesis: a young earth organization

2010-06-27T21:55:00.000-07:00

1. National Geographic News: “‘Lucy’ Kin Pushes Back Evolution of Upright Walking?”

He’s the new “big man” of human evolution: Kadanuumuu, a purported relative of famous ape-woman Lucy.

The fossil hominid was found in 2005 in Ethiopia, and received its nickname thanks to its height: between 5 and 5.5 feet (1.5–1.8 m). That’s relatively tall compared to Lucy, believed to be an ancestor of Kadanuumuu, who stood around 3.5 feet (1.1 m). According to the scientists describing the fossil in the journal Proceedings of the National Academy of Sciences, Kadanuumuu is an Australopithecus afarensis, like Lucy; however, the “big man” is dated older than Lucy, at 3.6 million years. (The find has also been nicknamed “Lucy’s great-grandfather.”)

But there’s a twist: Kadanuumuu’s skeletal features are unexpectedly similar to those of modern humans, according to Cleveland Museum of Natural History curator of physical anthropology Yohannes Haile-Selassie. “We can now confidently say that ‘Lucy’ and her relatives were almost as proficient as we are walking on two legs,” said Haile-Selassie. “The elongation of our legs came earlier in our evolution than previously thought.”

Additionally, Kadanuumuu’s shoulder blade is not as ape-like as the scientists expected. “Most scientists presumed that our ancestors’ shoulders were more like those of chimpanzees,” explained Haile-Selassie. Instead, Kadanuumuu’s shoulder blades are quite different from modern apes’. Based on that, the scientists conclude that Kadanuumuu and Lucy were no better at swinging in trees as modern humans are. “Its anatomy wouldn’t allow it to be [primarily] a tree-climber, as claimed by some people,” noted Haile-Selassie; on the other hand, “[Kadanuumuu] could actually stand on one leg and keep its balance[,] something chimpanzees cannot do.”

Disagreeing with Haile-Selassie is California Academy of Sciences anthropologist Zeresenay Alemseged, who discovered the fossil nicknamed Selam considered a juvenile A. afarensis. (We reported on this discovery in September 2006.) He argues that the limited remains of Kadanuumuu mean scientists cannot be certain what species it is, and that differences with Lucy and Selam show Kadanuumuu to be something other than A. afarensis. (ScienceNOW reports that the find is only forty percent complete—and lacks a head.)

The debate underscores one of the biggest problems with forming grand conclusions from fossil hominids: most of the fossils are woefully incomplete, with guesswork and presupposition-soaked interpretations filling in the gaps (a problem that ultimately obstructs both evolutionist and creationist study of the fossils). As a consequence, it’s no surprise that Lucy, Selam, and Kadanuumuu’s features may seem incompatible—they may not be the same species after all; indeed, it may be that, e.g., one is a true human while the others are not.

Given Kadanuumuu’s missing bones (especially his head) and the fact that most mainstream researchers—let alone creationists—have not yet studied the find up close, it’s difficult to draw any clear conclusions about whether Kadanuumuu was human or ape, or whether it was indeed a relative of Lucy or not. Based on Haile-Selassie’s endorsement of the similarity between Kadanuumuu and modern humans, along with creationists’ general skepticism over Lucy’s humanity, we are inclined to consider Kadanuumuu a human whose evolutionarily determined age and lack of head has him falsely lumped with what are almost certainly apes.
For more information

2. ScienceDaily: “Canyon Carved in Just Three Days in Texas Flood: Insight into Ancient Flood Events on Earth and Mars”

With a headline worded as if written by a young-earther, the press release for a new study of Texas’s Canyon Lake Gorge reveals that an increasing number of scientists are coming to grips with catastrophic geology.

Young-earth scientists once caused a major controversy (indirectly) for arguing that Grand Canyon was formed rapidly. But recent events have given scientists of all stripes an appreciation for the geologic power of “a lot of water in a little time”—which contrasts with the commonly accepted model of “a little water in a lot of time,” used to explain such formations as Grand Canyon.

In October 2007, we reported on the overflow of Canyon Lake and the formation of Canyon Lake Gorge, which occurred in 2002 (before News to Note was around). At a little over a mile (2 km) long and an average depth of 23 feet (7 m), the gorge is far smaller (to say the least) than Grand Canyon; but given that it formed in just three days of heavy flooding, it’s instructive regarding the power of fast-moving water.

Now, California Institute of Technology geologist Michael Lamb and Texas State University geographer Mark Fonstad report in Nature Geoscience some of the implications that the indubitably rapid formation of the canyon has for mainstream geology. The press release states:

Our traditional view of deep river canyons, such as the Grand Canyon, is that they are carved slowly, as the regular flow and occasionally moderate rushing of rivers erodes rock over periods of millions of years. Such is not always the case, however.

The scientists used a combination of aerial photography and field measurements of the area where the gorge now lies to estimate the rate of erosion during the flood. Amazingly, the team determined that the rate of erosion was limited only by the amount of sediment the floodwater could carry—which speaks volumes for the erosive power of the retreating waters of a global Flood.

“This is one of a few places where models for canyon formation can be tested because we know the flood conditions under which this canyon formed,” Lamb stated. His point, while presumably not intended as such, reminds us that when it comes to most geologic formations, we haven’t observed how they formed. All bring some sort of presuppositions to the table—such as that natural processes have persisted, basically unchanged, over time, or that God sent a worldwide Flood to destroy humankind.

We can’t be any clearer than what we said back in 2007 about the significance of the gorge: “[I]f a single overflowing spillway in Texas can carve a mile-and-half-long, 80-foot-deep gorge in three days, imagine the geological havoc that a worldwide Flood—and its retreat—would cause over the span of more than a year!”
For more information:

3. BBC News: “Fin to Limb Evolution Clue Found”

Could a loss of genetic information have been responsible for one of evolution’s supposed great leaps forward?

Stiff-finned fish boldly setting “foot” on land millions of years ago is one of the most well-known chapters in the evolutionist’s history book. But while creationists have dismissed such transitions as requiring unfounded increases in genetic information, a new study suggests a loss of genetic information may have contributed to the fish-walking transition. Could it be so?

Reporting in Nature, the team, led by the University of Ottawa’s Marie-Andree Akimenko, describes two genes that play an important role in the development of zebrafish fins. More specifically, the genes code for proteins that build fibers called actinotrichia. Later, the fibers form bony fin rays in mature fish fins. Unsurprisingly, when the team deactivated the genes in zebrafish embryos, the fins that developed were “truncated.”

The team then compared the zebrafish fin development to the maturation of mouse limbs. Akimenko explained, “When we compared fin development and limb development, the early steps are very similar. But at one point there is a divergence, and that correlates with the beginning of the expression of these genes.” The scientists therefore conclude that these genes were lost during the evolutionary transition of some fish to land-walkers.

While BBC News describes the alleged loss as a “key step” in the evolution of tetrapods, we find two major faults with the study. First, the idea that the genes were “lost” during an evolutionary transition presupposes that an evolutionary transition did, in fact, occur—it interprets the presence of the genes in zebrafish and their absence in mice to an event in evolutionary history rather than to differential design. Second, the disappearance of actinotrichia and bony rays in fish fins does not account for the complex genetic changes (leading to skeletal and muscular changes) that would allow fish-like creatures to support their full weight while moving on land. As such, the evidence for this evolutionary transition remains undiscovered and, in our opinion, nonexistent.

Earth is unique

2010-06-27T21:51:00.001-07:00

12/21/2009
by Dr. Hugh Ross

Earth is not at all ordinary in its assortment of elements and compounds. For the planet’s size and distance from its star, it possesses an anomalous (abnormal) amount of every measurable element and compound. Today, the list of such uniquely abundant or scarce substances includes water, carbon, sulfur, phosphorus, uranium, and thorium. Each of these anomalous amounts proves to be a vital requirement for advanced life and a significant piece of evidence that Earth was supernaturally designed for humanity’s benefit.

A study performed by two MIT planetary scientists showed that Earth is actually lacking in both water and carbon. They produced the most detailed model to date of degassing during the accretion phase of planetary formation for planets ranging in mass from 1 to 30 times the mass of Earth.1 The team based their models on measurements of the bulk compositions in the most primitive meteorites found in the solar system. These ancient remnants of the solar system’s protoplanetary disk represent the material from which Earth formed. They contain up to 20 percent by mass of water.

Using the range of water and carbon found in such meteorites and modeling how much of that water and carbon would be retained in the formation process by Earths and super-Earths, the MIT scientists determined that degassing during the accretion process alone would result in water and carbon compounds making up to 20 percent and 5 percent of the mass of Earths and super-Earths, respectively. They found, too, that using even modest estimates of water and carbon in the meteorites resulted in Earths and super-Earths ending up with very deep oceans and very thick atmospheres.

The problem posed by deep oceans is that no conceivable amount of plate tectonic activity would ever produce continents. Without continents there would be no possibility for land life, and many important nutrient-recycling mechanisms would be absent. The problem posed by thick atmospheres loaded with carbon compounds is that such atmospheres would trap tremendous amounts of heat, would result in such high atmospheric pressures as to make lungs inoperable, and would block out so much stellar light as to impede photosynthesis.

While water and carbon are essential for life, too little or too much proves deadly, especially in the case of advanced life. Earth possesses the just-right amount of each. The MIT team’s study underscored Earth’s uniqueness. For a planet as large as it is and as far away as it is from its star, Earth is miraculously water- and carbon-poor. Water makes up just 0.02 percent of Earth’s mass; carbon just 0.003 percent.

Measurements on Mars reveal another way in which our life-friendly home is unusual among its planetary peers. Earth is sulfur poor, especially in the sulfur compounds most hazardous to life. Two planetary scientists, Fabrice Gaillard and Bruno Scaillet, determined that the Martian mantle contains at least three to four times as much sulfur as does Earth’s and that volcanic gas emissions during the late stages of Mars’ history are ten to a hundred times richer in sulfur and sulfur compounds than similar emissions on Earth.2

Mars’ atmosphere was tenuous (just one bar or less) during the late stages of its history. Such a thin atmosphere implies that the sulfuric volcanic gases Mars retains are dominated by heavier sulfur dioxide rather than by hydrogen sulfide. This sulfur dioxide can penetrate any existing persistent water layer on Mars, making such water much too acidic for the origin of life or for the maintenance of anything other than the most extreme acidophilic bacterial species.

Too much sulfur on a planet is deadly to life. But Gaillard and Scaillet do not address whether Earth or Mars is the exception among planets.

Sulfur ranks as the tenth most abundant element in the universe. Its abundance by weight is 500 parts per million. This compares with 1,100, 700, and 600 parts per million, respectively, for iron, silicon, and magnesium, which rank seventh, eighth, and ninth. Yet in Earth’s crust, sulfur ranks as only the seventeenth most abundant element. There, its abundance by weight is 0.04 percent. The abundance levels for iron, silicon, and magnesium are 4.10, 27.71, and 2.30 percent, respectively. Thus, relative to iron and magnesium, sulfur is fifty times less abundant in Earth’s crust than it is in the universe.

Phosphorus, an element crucial for the assembly of DNA and RNA molecules, and likewise critical for metabolic reactions in all organisms, is super-abundant in Earth’s crust. Relative to magnesium and iron, phosphorus is four times more abundant in Earth’s crust than it is in the universe or the Sun.

Relative to magnesium and iron, uranium and thorium, which provide most of the energy driving plate tectonics, and thereby making continents possible, are about 10,000 and 1,000 times more abundant in Earth’s crust, respectively, than in the universe or the Sun. They are both much more abundant in the planet’s interior (the necessary location for the energy driving plate tectonics) than in the crust.

The table below summarizes Earth’s anomalous abundances of elements. Every one of our planet’s exceptional abundance characteristics discovered so far has proven to be essential for the support of life and of advanced life in particular. The evidence for the supernatural, super-intelligent design of Earth is mounting.

Earth’s Anomalous Abundances
carbon 500 times less
water 250 times less
sulfur 50 times less
phosphorus 4 times more
uranium 10,000 times more
thorium 1,000 times more

References:

1. Linda T. Elkins-Tanton and Sara Seager, “Ranges of Atmospheric Mass and Composition of Super-Earth Exoplanets,” Astrophysical Journal 685 (October 1, 2008): 1237–46.

2. Fabrice Gaillard and Bruno Scaillet, “The Sulfur Content of Volcanic Gases on Mars,” Earth and Planetary Science Letters 279 (March 15, 2009): 34–43.

Animals are created after their "kind" in the previous world not evolved

2010-06-23T06:40:00.000-07:00

ScienceDaily (June 16, 2010) — The world's oldest known example of a fig wasp has been found on the Isle of Wight. The fossil wasp is almost identical to the modern species, proving that this tiny but specialized insect has remained virtually unchanged for over 34 million years.

The fossil isn't a new find but was wrongly identified as an ant when it was first discovered in the 1920s. Fig wasp expert at the University of Leeds, Dr. Steve Compton, was called in to study the fossil when the late Dr. Mikhail Kozlov spotted the mistake during research at the Natural History Museum, London into the flora and fauna of the Isle of Wight. The findings of Dr. Compton and the team are published in the Royal Society journal Biology Letters.

"There were three very well-preserved specimens and we were able to use modern techniques to look at them in detail," says Dr. Compton. "What makes this fossil fascinating is not just its age, but that it is so similar to the modern species. This means that the complex relationship that exists today between the fig wasps and their host trees developed more than 34 million years ago and has remained unchanged since then."

Fig wasps and fig trees are mutually dependent, with each of the 800 or so modern species of tree pollinated by just one or two species of fig wasp that ignore other fig trees. The wasps -- which measure just 1.5 mm in length -- have developed a particular body shape and features to enable them to crawl into figs to reach the flowers there.

Tower of Babel from Answers in Genesis

2010-06-21T21:04:00.000-07:00

The World in Revolt
Understanding the Rebellion at Babel
by Mike Matthews
February 4, 2008

Nations that once feared God now ignore Him and despise His Word. Children from godly homes are rebelling against the faith of their parents. Not much has changed in the last four thousand years, since Babel.

God recorded key moments in history to warn and comfort His people (1 Corinthians 10:11; Romans 15:4). We may get discouraged by the sins of our nation and our children, but God wants to encourage us. A quick walk through the Bible’s account of Babel reveals some important lessons for us today. God is still patiently working out His plans, even though we can’t always see how.
Man in Rebellion Against God

Babel began with a heart of rebellion. Illustrations by Jon Taylor.
“Now the whole earth had one language and one speech.” (Genesis 11:1)

To properly understand the account of Babel, we must remember the circumstances in which Moses presented it to the Hebrew people. They had just been freed from slavery in Egypt around 1491 BC. They were about to enter the Promised Land and annihilate the wicked nations of Canaan. They needed to understand where nations came from and why God had the authority to judge them for their sin.

Moses knew about the history, geography, languages, and cultures of his world. He had been trained in the court of pharaoh. Yet he did not rely on his education because God spoke to Him directly. God’s words—whether spoken to Moses or recorded in the Bible for us today—are the highest authority we could or should ever want.

God’s claims do not have to be “proven,” yet the evidence lines up with God’s statements about the past. Genesis 11:1–9 describes a unique revolution in human history. At first, all people on earth were literally of “one lip” and “one words.” They had the same grammar and vocabulary. But as a result of God’s judgment, their language was divided into several languages, according to “families.” This is what we find today.
“They found a plain in the land of Shinar, and they dwelt there.” (v. 2)
Possible location of Babel

Babel was most likely located in Mesopotamia. The Bible tells us that the nations were divided from this location.

After the Flood (about 2348 BC, according to Ussher) God had commanded Noah’s descendants to “be fruitful, and multiply, and replenish the earth” (Genesis 9:1), but instead they took up permanent residence, with no apparent intention to spread out.

This rebellion, which took place a century or two after Noah’s Flood, was no surprise to God. While promising not to send another Flood, God told Noah that human sinfulness was still a problem: “The imagination of man’s heart is evil from his youth” (Genesis 8:21). Rebellion has been a pattern ever since Adam disobeyed God.
“Come, let us make bricks and bake them thoroughly.” (v. 3)

Where did these early humans learn to build a city and tower? Long before Noah’s Flood, Cain was a city-builder, and his descendant Tubal-cain was gifted in brass and iron (Genesis 4:17–22). It is clear from the genealogies in Genesis that Noah lived among these people for six hundred years before the Flood came, acquiring their technology and possibly their books. His sons had plenty of time to develop their construction skills, too, while building the Ark.
“Come, let us build ourselves a city and a tower . . . lest we be scattered abroad.” (v. 4)

The settlers at Babel went out of their way to ensure that they would not be scattered, contrary to what God had commanded. They put down roots in one place, including a tower that they could rally around.
Planning the tower of Babel

Contrary to God’s command, the settlers at Babel planned to stay together.

Notice the words us, ourselves, and we. Moses makes it clear that pride was the real problem at Babel. Building cities and towers is not evil, but proud motives can turn even the most worthwhile activities into sin. Any human activity, done for the wrong reason, is wicked, as Proverbs 21:4 warns (“The plowing of the wicked is sin”).

The rebels wanted to build their tower “whose top is in the heavens.” This figure of speech, a hyperbole, is similar to the description of the cities in Canaan as “walled up to heaven” (Deuteronomy 1:28).

There is some question about the purpose of the tower. Some have suggested they wanted to build a structure large enough and strong enough to survive another Flood, but why would they build the tower in the plains rather than on a mountain? Other commentators, such as Luther, suggest that the builders wanted to construct a symbol of their self-reliance. The rebels were shaking their fist at heaven, as it were, by building such a great structure in their own power.

Early Jewish writers and Christian commentators suggested that the tower was the first center of false religion in the post-Flood world. (Revelation 17:5 also indicates that Babel was the mother of world religions.) One recent suggestion is that, like ziggurats built in later cities of the region, the tower was a symbolic bridge between heaven and earth, a place where the gods could come down to earth or rest (David S. DeWitt, Journal of the Evangelical Theological Society 22:1, p. 19).

While God does interact with humans in unusual ways (see Jacob’s ladder in Genesis 28:12), it is the height of folly for humans to think they can bridge the gap between the physical world and the spiritual world by their own efforts.
“. . . and let us make a name for ourselves.” (v. 4)

This sentence reveals the arrogance of the people at Babel. They sought a name for themselves rather than to honor the name of their Creator, who is above all and whose name is worthy of all praise.

The settlers at Babel sought to glorify themselves rather than to honor the name of their Creator. Illustrations by Jon Taylor.

Throughout history, humans have longed to share God’s glory. The serpent tempted Eve with the promise that she and Adam could “be as gods.” All man-made religions try to “honor” God by the works of our own hands. God, in contrast, is not impressed by our works. He desires obedience and humility (1 Samuel 15:22–23). Moses’s account reminds us how we are all naturally stubborn and rebellious.

Ironically, if we are humble and obedient, God will honor our name. Moses shows this by contrasting the events at Babel with the later faithfulness of Abraham. God promised to make Abraham’s name great, and all he needed was humble faith (Genesis 12:2).
“But the Lord came down to see the city and the tower.” (v. 5)

This verse marks the dramatic turning point in Moses’s account of the events at Babel. God takes note of man’s plans. Then He steps in to reverse them.

Repeatedly, we learn that God observes our actions (Adam, the wicked generation of Noah’s day, Babel, Sodom and Gomorrah, etc.), and He judges us accordingly. Nothing escapes God’s attention. No individual sin, no sin of a nation. That is the lesson of Babel.
“. . . now nothing that they propose to do will be withheld from them.” (v. 6)

This is one of the most amazing claims in the Bible. God has truly given mankind incredible gifts. He can fly to the moon, land probes on comets, and peer into the deepest recesses of the universe.

God gave us these talents for the purpose of glorifying His name, but our incredible gifts, if used for the wrong purpose, can destroy us. So God “restrains” humans. Unlike the judgment during Noah’s day, when God wiped out the entire world, here He intervened before the rebellion had gone too far.
“Come, let us go down and there confound their language.” (v. 7

We can see God’s mercy in His judgment at Babel.

God’s gentleness in judging the rebels at Babel is a lesson for us today. God did not let man’s rebellion run its full course, as He had before Noah’s Flood. He nipped the rebellion in its early stages so that humans would not hurt themselves too much.

By changing one language into many, He separated nations more effectively than any Wall of China. God stepped in to prevent the human race from falling under the sway of a single, absolute tyrant over all the earth. Only in His time would Christ gather together God’s family from every nation and tongue (Revelation 7:9).

Note God’s ironic words. Just as the rebels said, “Let us build a tower,” God said, “Let us confound their language.” Man’s counsels can’t stand in the face of God’s counsel. As the original creator of human speech, God could easily rewire speech so that the evil speakers could no longer speak to one another.
“So the Lord scattered them abroad.” (v. 8)

Moses closes this account with a reminder that God will always accomplish His will. We may think we have found a way to circumvent His will, but that is just an appearance. As King Solomon later wrote, “The king’s heart is in the hand of the Lord, like the rivers of water; He turns it wherever He wishes” (Proverbs 21:1).
People scattered

The end result of God’s judgment was the scattering of the settlers. Illustrations by Jon Taylor.

By this simple act, God forced humanity to proceed down His chosen path—to resettle the earth by families.

God’s first judgment after the Flood proved that He would continue to superintend the events of human history. God wants us to turn to Him, rather than relying on ourselves. One day, whether they like it or not, all people will bow their knee before the name of Jesus Christ, the true bridge between heaven and earth (Philippians 2:9–11).
“Therefore its name is called Babel.” (v. 9)

Mankind’s rebellion came full circle. The people earned a name for their city, but not a name of their own choosing. Their city’s name became Babel, from a related word meaning “confusion.”

But the story does not end there. The next verse opens a new chapter in the history of mankind: “This is the genealogy of Shem” (Genesis 11:10). The history of this family becomes the focus of the rest of the Old Testament.

Through Abraham, a descendant of Shem, all the nations on earth would be blessed. God had promised Abraham that He would make of him a great nation and make his name great (Genesis 12:2). God planned that the nations would one day learn about a Savior, Jesus Christ, who would descend from Abraham. All along, God had planned eventually to build a city, united under the rule of Christ. Unlike impatient man, however, God would patiently build this city on His own timetable.

With the eyes of faith, Abraham looked for this city, “whose builder and maker is God” (Hebrews 11:10). In contrast to the tiny cities built by human hands, God’s city will be everlasting, built on a grand scale, approximately 1,500 miles (2,225 km) square and 1,500 miles high, with streets of gold and walls of precious jewels (Revelation 21:16).

God’s plans included an incredible way for repentant sinners to join Him in this city—by faith in Jesus Christ. With His dramatic miracle at Pentecost when people from nations all over the earth first heard the gospel in their own tongue, God let the world know that He had begun overcoming the effects of Babel. Since then, He has been patiently fulfilling His plan to call people to His eternal city “out of every tribe and tongue and people and nation” (Revelation 5:9).
Mike Matthews earned a BA in English and an MEd in English education from Bob Jones University. Mike was the content manager for the Creation Museum and now is the executive editor for Answers magazine.

Proof for a Unique Sun

2010-06-15T20:06:00.001-07:00

Rare Solar System, Rare Sun

12/14/2009
by Dr. Hugh Ross

The first discovered extrasolar planet was found in 1995, orbiting the nearby star 51 Pegasi.1 This finding persuaded many astronomers and millions of lay people to conclude that Carl Sagan was right—our Milky Way Galaxy (MWG) was filled with billions of planets, most of which would prove to be analogues to the planets in our solar system. Sagan concluded that this, in turn, would imply that life would be present on several million of them. The subsequent discovery of dozens more extrasolar planets before the end of the twentieth century further stirred the hope that we soon would be able to “explore strange new worlds, to seek out new life and new civilizations, to boldly go where no man has gone before.”

Teams of astronomers from all over the world continue to search for strange new worlds. As of December 11, 2009, these groups have found a total of 407 planets. Yet not a single one is an analogue to any of our solar system’s planets. None of the newly discovered planetary systems permit the existence of a planet like Earth. The exuberant vision imparted by Sagan has, for nontheists, turned into a dirge. In his book God: The Failed Hypothesis, atheist and particle physicist Victor Stenger laments that Earth, “a tiny blue speck in a vast universe,” is alone, the only locale where advanced life might exist.2

Now, an international team of astronomers, led by the Peruvian astronomer Jorge Meléndez, has discovered at least one reason why the Sun’s planets are proving unique.3 Meléndez has devoted much of his career to the quest to find a star that would qualify as a true twin of the Sun, in the sense that the star would possess all the characteristics necessary to make possible the existence of advanced life on a planet orbiting it. In 2006, he wrote, “Despite the observational effort carried out in the last few decades, no perfect solar twin has been found.”4

In an ongoing effort to understand why the Sun appears unique among all the stars in the MWG, Meléndez joined forces with three other astronomers to study the Sun’s composition relative to stars closest to being its analogues or twins. A solar analogue is a star that roughly approximates the mass, age, and spectral type of the Sun, what astronomers would indentify as a main sequence dwarf between spectral type G0 and G5 (the Sun spectral type is G2). A solar twin is a star whose characteristics are “almost identical to the Sun’s.”

Meléndez’s team performed “a differential elemental abundance analysis of unprecedented accuracy (~0.01 dex) of the Sun relative to 11 solar twins from the Hipparcos catalog and 10 solar analogs from planet searches.”5 In other words, they compared the abundances of different atomic elements in the Sun with abundances of the same elements seen in the most solar-similar stars to a precision never before achieved.

They found that the Sun possesses a startling unique elemental signature. Compared to the best solar twins, the Sun has about a 20 percent depletion of refractory elements relative to volatile elements. The refractory elements include aluminum, calcium, magnesium, and silicon that figure prominently in interplanetary dust, meteorites, and rocky planets like Earth. The volatiles are elements like carbon, nitrogen, and oxygen that factor into the gas molecules that make up the planetary atmospheres.

The only rational explanation Meléndez’s team could discern for the Sun’s elemental abundances was the unique system of planets orbiting the Sun. A few relatively small gas giant planets (volatile-rich planets) orbit the Sun at large distances, and some relatively medium-sized rocky planets (refractory-rich planets) orbit at close-in distances from the Sun. Meléndez’s team concluded that the peculiar solar elemental composition “would imply that solar-like stars with planetary systems similar to our own are a relatively rare occurrence.”6

Are the Sun and its system of planets so unusual that their rarity forces the conclusion that both were supernaturally designed for the specific benefit of the human species (known as the anthropic principle)? The evidence accumulated so far looks that way. However, the evidence comes from a database of only 21 stars. Before drawing any firm anthropic principle conclusions, pro or con, Meléndez argues that detailed comparisons with many more stars and planets are necessary.7 We agree and look forward to even more stringent tests of competing explanatory models for the universe and its stars and planets.

References:
1. M. Mayor and D. Queloz, “A Jupiter-Mass Companion to a Solar-Type Star,” Nature 378 (November 23, 1995): 355.

2. Victor J. Stenger, God: The Failed Hypothesis (Amherst, New York: Prometheus Books, 2007): 154–62. The quote is on page 160.

3. J. Meléndez et al., “The Peculiar Solar Composition and Its Possible Relation to Planet Formation,” Astrophysical Journal Letters 704 (October 10, 2009): L66–L70.

4. Jorge Meléndez, Katie Dodds-Eden, and José A. Robles, “HD 98618: A Star Closely Resembling Our Sun,” Astrophysical Journal Letters 641 (April 20, 2006): L133.

5. J. Meléndez et al., L66.

6. J. Meléndez et al., L69.

7. J. Meléndez et al., L69–L70; Jorge Meléndez and Iván Ramírez, “HIP 56948: A Solar Twin with a Low

Rebuttal to Richard Dawkins criticism of design of the human eye

2010-06-08T18:29:00.000-07:00

By Faz Rana from reasonstobelieve.org
In 1996, evolutionary biologist Richard Dawkins wrote in regards to the vertebrate retina,

Any engineer would…laugh at any suggestion that the photocells might point away from the light, with their wires departing on the side nearest the light. Yet this is exactly what happens in all vertebrate retinas. Each photocell is, in effect, wired backwards.1

The retina is a thin layer of light-responsive neural cells lining the interior back wall of the eye. It consists of photoreceptor cells that generate an electrical signal when light impinges upon them. At first glance the retina appears to be based on a questionable design. The light-sensitive region of photoreceptor cells orients away from the source of light. Furthermore, the nerve cell conduits to the optic nerve lie between the light source and photosensitive region of the photoreceptor cells—a design that would make any self-respecting engineer cringe.

Thus, vertebrates’ “backward-wired” retina became an exemplar of bad design. Evolutionary biologists like Dawkins consider faulty designs in biological systems as prima fascia evidence that life stems from undirected mechanistic processes, not from the activity of a Creator.

Debunking the myth
But further research into the construction and function of the vertebrate eye has unraveled the bad design myth. Most recently, a team of Israeli physicists performed modeling studies on the optical properties of radial glial cells. Their results confirm previous work by German scientists.2

In 2007, a team of German researchers demonstrated that radial glial cells associated with the retina act as optical fibers.3 That is, the radial glial cells (star-shaped cells that help maintain the structure of nervous tissue and transport nutrients to neurons) form fibers oriented in the direction of light propagation through the retina. This allows them to efficiently transmit light from the surface of the retina to the photoreceptors. Radial glial cells have a higher refractive index than the surrounding tissue matrix, serving as a low-scattering conduit for light, and thus transmitting images capably and with little distortion.

The work by the Israeli physicists supports the conclusion that these optical fibers compensate for the retina’s “bad design.”

In light of these new insights, it is easy to see that the inverted retina is a well-designed system, worthy of the Creator.

Endnotes:

1. Richard Dawkins, The Blind Watchmaker: Why The Evidence of Evolution Reveals a Universe without Design (New York: W.W. Norton, 1996), 93.

2. A. M. Labin and E. N. Ribak, “Retinal Glial Cells Enhance Human Vision Acuity,” Physical Review Letters 104 (2010).

3. Kristian Franze et al., “Müller Cells are Living Optical Fibers in the Vertebrate Retina,” Proceedings of the National Academy of Sciences, USA 104 (May 15, 2007): 8287–92